ID: 1175859604

View in Genome Browser
Species Human (GRCh38)
Location 20:62143265-62143287
Sequence GTCGGGCGAGAAGACGGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175859594_1175859604 11 Left 1175859594 20:62143231-62143253 CCTCCTGCGCGTACTCCACTTGG 0: 1
1: 0
2: 0
3: 6
4: 43
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77
1175859592_1175859604 24 Left 1175859592 20:62143218-62143240 CCCTTCTTGACGGCCTCCTGCGC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77
1175859593_1175859604 23 Left 1175859593 20:62143219-62143241 CCTTCTTGACGGCCTCCTGCGCG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77
1175859596_1175859604 8 Left 1175859596 20:62143234-62143256 CCTGCGCGTACTCCACTTGGAAG 0: 1
1: 0
2: 0
3: 9
4: 41
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77
1175859599_1175859604 -4 Left 1175859599 20:62143246-62143268 CCACTTGGAAGAGGTGGCCGTCG 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175859604 Original CRISPR GTCGGGCGAGAAGACGGTGA TGG Exonic
903034075 1:20483807-20483829 GTCGGGAGAGGAGAGGGCGAGGG + Intronic
904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG + Intergenic
904831300 1:33307900-33307922 GTGGGGTGAGAAGGGGGTGAAGG - Intronic
908655965 1:66389221-66389243 GTTGGGGGAGAAGACTCTGAAGG + Intergenic
911348338 1:96722382-96722404 GTCGGGAGAGATGCCGGTGGCGG + Intronic
912385366 1:109268738-109268760 GTTGGGCGTGACGATGGTGAAGG - Exonic
918356366 1:183709262-183709284 GCTGGGCGGGAAGAGGGTGAGGG - Intronic
1063603780 10:7505735-7505757 GTCCGGAGAGAAGAAGGGGAAGG - Intergenic
1065096410 10:22285108-22285130 GTCTGGGGAGAAGAGGATGAGGG - Intergenic
1066464462 10:35640584-35640606 GCCGATCCAGAAGACGGTGAAGG + Exonic
1069258587 10:66365064-66365086 GTCAGGCGAGAAAACAGGGAGGG + Intronic
1077003072 11:334776-334798 GTGGAGAGAGAAGACAGTGAGGG - Intergenic
1077408654 11:2393574-2393596 GTGGTGCGAGAAGAGGGTGGGGG - Intronic
1078076684 11:8168718-8168740 GGCGGGCGAGACGGCGTTGAAGG - Intronic
1081692664 11:45088692-45088714 GTTGGGGGAGAAGAATGTGAGGG + Intergenic
1087628722 11:100625272-100625294 GTGGGGTGAAAAGACAGTGAGGG - Intergenic
1090744927 11:129697694-129697716 GTGGGGAGAAAAGAGGGTGAAGG + Intergenic
1092445386 12:8551205-8551227 GTCGAGAGAGAAGACAGGGATGG + Intergenic
1099884319 12:88508583-88508605 GTTGGGGGAGGAGACAGTGAGGG + Intronic
1101259463 12:103013600-103013622 GTGGGGCGGGAAGCGGGTGAGGG + Intergenic
1106850942 13:33790732-33790754 GAAGGACGAGAAGAAGGTGAGGG + Intergenic
1117353008 14:54899804-54899826 GACTGGCGAGAAGAGGGGGATGG - Intronic
1122369862 14:101223548-101223570 CTGGGGAGAGAAGACAGTGAGGG + Intergenic
1127370588 15:58335084-58335106 GTTGGGAGAAAAGACTGTGAAGG - Intronic
1129165035 15:73771982-73772004 GTCGGGTGAGAAGACCCTGGGGG - Intergenic
1131055180 15:89370773-89370795 GGCAGGCCAGAAGACGTTGATGG - Intergenic
1132546104 16:534192-534214 GTCGTGGGAGGCGACGGTGAGGG + Intronic
1141263461 16:82474692-82474714 GTGGGGCAAGAAGATTGTGAAGG + Intergenic
1142419384 16:89961106-89961128 GCAGGGAGAGAAGAGGGTGAGGG + Intronic
1142669144 17:1479511-1479533 GGCAGGCGAGGACACGGTGAGGG + Intronic
1142970866 17:3610712-3610734 GTGGGGCGTGGAGAGGGTGATGG - Exonic
1146954338 17:36928376-36928398 GTGGGGGTAGAAGGCGGTGAGGG + Intergenic
1152786107 17:82248917-82248939 GTCGGACGAGGAGATGTTGACGG + Exonic
1152799364 17:82323743-82323765 GTCGGGGGAGAAGAGGCAGAGGG + Intronic
1156228177 18:35129347-35129369 CTCGGGCGAGGAGAGGCTGAGGG + Intronic
1158661365 18:59391319-59391341 GTAGGGAGAGAAGAAGGAGAAGG - Intergenic
1160209055 18:76860939-76860961 GTCTGGCGTGAAGCTGGTGAGGG + Intronic
1167587222 19:50382059-50382081 GTCGGCCGAGAAGATGTTGATGG - Exonic
1167607358 19:50488562-50488584 GTTGGGGGAGAAGAGGGTGGGGG + Exonic
929501177 2:42493112-42493134 GTCGGCCGAGTAGAAGGTGTAGG + Exonic
1169495684 20:6112804-6112826 GTGGGGGGAGAAAACGGTGGAGG + Intronic
1169754602 20:9030551-9030573 GTCTGGAGAGAAGATGCTGAAGG + Intergenic
1175859604 20:62143265-62143287 GTCGGGCGAGAAGACGGTGATGG + Exonic
1180959371 22:19755653-19755675 GGCGGGAGGGAGGACGGTGAGGG + Intergenic
1181484506 22:23222122-23222144 GACAGGTGAGAAGACGGGGAGGG - Intronic
956695325 3:71914021-71914043 GGAGGGCGAGACGAGGGTGAAGG - Intergenic
956747352 3:72320381-72320403 GTTGGGTGAGAAGACGCTCAGGG - Intergenic
958626495 3:96631631-96631653 GTGGGGGGAGAAAATGGTGAAGG + Intergenic
958883559 3:99700441-99700463 GTGGGGCCAGAAGAGCGTGAGGG - Intronic
962077438 3:132097676-132097698 GTTGGGCGAGAAGATGGGCATGG + Intronic
966941871 3:184753013-184753035 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941956 3:184753377-184753399 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941971 3:184753432-184753454 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942001 3:184753542-184753564 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942048 3:184753740-184753762 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942080 3:184753866-184753888 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942110 3:184753976-184753998 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942161 3:184754170-184754192 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942216 3:184754386-184754408 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
967556359 3:190863103-190863125 GCCGGGCGAGAAGATGGTCCAGG + Intronic
981073736 4:140570496-140570518 GTAGGGCAAGAAGTTGGTGAGGG + Intergenic
981612428 4:146609149-146609171 GTCTGGCCAGAATACAGTGAAGG - Intergenic
985641325 5:1064743-1064765 GGACGGCGAGGAGACGGTGAAGG + Intronic
998406033 5:141875451-141875473 GTAGGGAAAGAAGAAGGTGAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004671263 6:17799934-17799956 GTCGGGTGAGAGGACAGTGATGG - Exonic
1015262916 6:131259048-131259070 GTCAGGAGAGAAGCCGGGGAGGG - Intronic
1022629266 7:32070445-32070467 GCTGGGCGAGGAGACGGGGAGGG - Intronic
1022943587 7:35261288-35261310 GGCGGGGGAGAAGGTGGTGAGGG + Intergenic
1026675696 7:72426176-72426198 GAAGGGCCAGAAGAAGGTGAGGG + Intronic
1032000026 7:128259216-128259238 GTGGGGAGAGAAGAGGGAGAAGG + Intergenic
1035655278 8:1300682-1300704 GTCGGCCTAGGAGACGGGGATGG + Intergenic
1052830163 9:33208678-33208700 GTCAGGGGAGAAGGTGGTGAGGG - Intergenic
1058237124 9:102503942-102503964 GTTGGGGAAGAAGAGGGTGAGGG + Intergenic
1189732358 X:44034452-44034474 GTGGGGAGAGAAGAGGGTTAAGG - Intergenic
1193656000 X:84198364-84198386 GTAGGGTGAGATGAAGGTGATGG + Intergenic
1196366320 X:114928247-114928269 TTTGGGAGAGAAGATGGTGAGGG - Intergenic
1197692857 X:129522453-129522475 GGCGGGGCAGAAGAGGGTGAGGG + Intronic
1200059369 X:153477368-153477390 GTCGGGAGACTGGACGGTGATGG - Intronic
1200155294 X:153971859-153971881 GTCGGGCGAGGAGGCGGAGCCGG + Intergenic