ID: 1175859625

View in Genome Browser
Species Human (GRCh38)
Location 20:62143382-62143404
Sequence GGGCGCGGGCGTAGTGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175859625_1175859640 17 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859640 20:62143422-62143444 CCTGCGCTGCCGGCGACGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 120
1175859625_1175859635 7 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859635 20:62143412-62143434 GGCGCCGTGTCCTGCGCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 138
1175859625_1175859643 27 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859643 20:62143432-62143454 CGGCGACGGGCGGCGTCAGGCGG 0: 1
1: 1
2: 0
3: 7
4: 100
1175859625_1175859638 14 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859638 20:62143419-62143441 TGTCCTGCGCTGCCGGCGACGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1175859625_1175859641 24 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859641 20:62143429-62143451 TGCCGGCGACGGGCGGCGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 77
1175859625_1175859637 13 Left 1175859625 20:62143382-62143404 CCGGCGCCACTACGCCCGCGCCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1175859637 20:62143418-62143440 GTGTCCTGCGCTGCCGGCGACGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175859625 Original CRISPR GGGCGCGGGCGTAGTGGCGC CGG (reversed) Exonic
900092284 1:925654-925676 GAGCGCGGGAGGAGGGGCGCCGG + Intronic
900123414 1:1059145-1059167 CCGCGCGGGCGGAGAGGCGCTGG + Intergenic
900511300 1:3062325-3062347 GGGCGCCGGTGTACTGGCGGCGG + Intergenic
900512746 1:3068243-3068265 GAGCGCGGGCGGAGAGGTGCGGG + Intergenic
900786772 1:4654664-4654686 GGGCGCGGGCGGCGGGGCCCCGG + Intergenic
901692780 1:10984438-10984460 GGGGCCGGGCGTGGTGGCTCAGG - Intergenic
901833024 1:11905629-11905651 GGGGCCGGGCGCAGTGGCTCAGG - Intergenic
902600905 1:17539744-17539766 GGGCGCGGGCGCAGTCCCGGCGG + Intergenic
903998576 1:27324042-27324064 GGGGCCGGGCGTGGTGGCTCAGG + Intronic
904148198 1:28412942-28412964 TGGCCCGGGGGTAGTGGTGCAGG - Intronic
904676208 1:32200734-32200756 GGGCGGGGGCGGAATGACGCGGG + Intronic
904682799 1:32240754-32240776 GGGCGCGGTCGTAGGGGCCCGGG - Intergenic
906290563 1:44617082-44617104 GGGCATGGGCGTAGGGGTGCTGG - Intronic
912315094 1:108661124-108661146 GGGCGCCGGCGTAGCCGCGGCGG - Intronic
915616791 1:157045618-157045640 GGGCGCGGGGCGAGCGGCGCCGG - Intergenic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
916749885 1:167714334-167714356 GGGCGCGGGCGGGGCGCCGCCGG + Intergenic
919640396 1:200039882-200039904 GGGCGCGGGAGTAGCCCCGCTGG + Intronic
921029698 1:211326758-211326780 GGGCGCGGGCGGAGGGGCGCGGG - Intronic
922204427 1:223434161-223434183 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
922821407 1:228487919-228487941 GGGCGGGGGCGGAGAGGCGCAGG - Intronic
1064086520 10:12349734-12349756 CGGCGCGGGCGCAGAGGCGGCGG - Exonic
1064409560 10:15093170-15093192 GGGCGGGGGCTGAGTGGGGCAGG + Intergenic
1064418233 10:15168722-15168744 GGGCGCGGGCGGGGCGGGGCGGG - Intergenic
1065110605 10:22436780-22436802 GGGCGAGGGGGTAGCGGCCCCGG - Intronic
1065140514 10:22714611-22714633 GGGCGCCGGCGTCATGACGCAGG + Intergenic
1066464408 10:35640355-35640377 GGGCGCGGGCGGCGCGGCGGCGG - Exonic
1067091232 10:43266708-43266730 CGGCGCGGCCGTCGTGGGGCCGG - Intronic
1069885040 10:71618351-71618373 AGGGGCGGGCGTAGGGGGGCAGG + Intronic
1070109415 10:73469259-73469281 GGGCAGGGGCGCAGTGGCTCAGG + Intronic
1070198030 10:74176834-74176856 GGACGCGGGCGCCGTGGCGCTGG + Intronic
1070811634 10:79301043-79301065 GGGCACGGGGGTGGTGACGCAGG - Intronic
1072021840 10:91410296-91410318 GGGCGGGGGCGGAGTGGCGGCGG + Exonic
1072700912 10:97640841-97640863 GGGCGCGGTCCGAGTGGCGGCGG + Exonic
1073325908 10:102643977-102643999 GGGCGCGGGCTGCGGGGCGCGGG - Intergenic
1074843222 10:117375244-117375266 GGGCGCGGGAGTAGGGGCCCGGG - Exonic
1075031887 10:119029601-119029623 GGGCGCGGGCGAGGTGGCCGGGG + Intergenic
1076948519 10:133666815-133666837 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076949506 10:133670125-133670147 GGGGGAGGGCGTGGTGGCGGTGG - Intronic
1076950490 10:133673424-133673446 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076951477 10:133676723-133676745 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076952467 10:133680033-133680055 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076953453 10:133683343-133683365 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076955423 10:133742994-133743016 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076956413 10:133746304-133746326 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076957401 10:133749613-133749635 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076958388 10:133752923-133752945 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076959374 10:133756222-133756244 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1076960361 10:133759532-133759554 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
1079390983 11:20022002-20022024 GGGAGCGGGGGTTGTGGCCCTGG - Intronic
1080124445 11:28715907-28715929 GGACGGGGGCATAGTGGCACCGG - Intergenic
1080406908 11:31987583-31987605 GGGCGCGGGGCTGGGGGCGCTGG + Intronic
1083171987 11:60928637-60928659 GGGCGCCTGCGTGGTGGAGCTGG + Exonic
1083453006 11:62758890-62758912 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1084172425 11:67406946-67406968 GGGAGCGGGCGAAGAGGCACAGG - Exonic
1087785312 11:102347395-102347417 GGGCTCGGGCGGCGTGGGGCGGG + Exonic
1089543770 11:119206648-119206670 GGGCGTGGGCGGAGGGCCGCGGG + Intronic
1090224841 11:125063607-125063629 GAGCGCGGGCGGAGTTGGGCAGG - Intronic
1091383581 12:78124-78146 GTGCGCGGGGGTTGGGGCGCGGG - Intronic
1091493228 12:950288-950310 GGGGCCGGGCGTGGTGGCTCAGG + Intronic
1091550195 12:1530717-1530739 GGGCGCGGGGCTGGCGGCGCGGG - Intronic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1092045943 12:5431983-5432005 GGGCGCGCGCGGCGCGGCGCGGG + Intergenic
1096435815 12:51590816-51590838 CGGCGGGGGCGTAGTGGAGGCGG + Intronic
1097281437 12:57847123-57847145 TGGCGCGGGGGGAGTGGCCCGGG - Intergenic
1102473777 12:113175504-113175526 GGGGCCGGGCGCAGTGGCTCAGG + Intronic
1103055327 12:117815693-117815715 GGGCGCAGACGCAGTGGCTCAGG + Intronic
1103085822 12:118061196-118061218 GGGCGCGGGCGGAGACGCGCGGG + Intronic
1103931627 12:124453768-124453790 GGGAGCGGGCGCAGTGGTGGAGG - Intronic
1107986951 13:45783931-45783953 GGGGGTGGGCGTGGTGGCGGAGG + Exonic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1111570056 13:90072859-90072881 AGGCGTGGGCGTGGTGGCTCAGG + Intergenic
1112290828 13:98143130-98143152 CGGCGCGGGCGCAGCGGTGCGGG + Intronic
1112309756 13:98308001-98308023 GGGGGCGGGCGGAGGGGGGCAGG - Intronic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113734447 13:112668142-112668164 GGGCGCAGTCGAAGTGGAGCAGG + Intronic
1115761404 14:36581530-36581552 TGGCGCGGGCGTGGAGGCACTGG + Intronic
1117131980 14:52695766-52695788 GGGCGCGGGCGCAGCGGACCGGG - Intronic
1118320717 14:64751399-64751421 GGGGCCGGGCGTGGTGGCTCAGG - Intronic
1121616993 14:95319929-95319951 GGGCGCGGGCGGGGCGGGGCGGG + Intergenic
1122545009 14:102517245-102517267 GGGGGCAGGCGCAGTGGCGGCGG - Intergenic
1122947851 14:105021310-105021332 GGGCGTGGGCGTGGCGGGGCCGG - Intergenic
1125301023 15:38253067-38253089 GGGCGCGGGGGCAGCGGCACAGG - Exonic
1126137158 15:45403083-45403105 GGGCGCGCGGGTAGCGGAGCGGG - Exonic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1132560227 16:590128-590150 GGGCGCGGGCGGGGCGGGGCCGG + Intronic
1132642741 16:985139-985161 GGGGGCGGCCGGGGTGGCGCTGG - Exonic
1132741294 16:1414576-1414598 GGGCGCGGGCGGGGGGCCGCAGG + Intronic
1133020325 16:2964206-2964228 GGGGGCGGGCGTAGAGGCTGAGG + Exonic
1135543579 16:23350957-23350979 GGGCACGGGCACAGTGGCTCAGG + Intronic
1136707673 16:32202529-32202551 GGGCGGGGGCGGAGCGGGGCGGG + Intergenic
1136760237 16:32726881-32726903 GGGCGGGGGCGGAGCGGGGCGGG - Intergenic
1136807867 16:33143505-33143527 GGGCGGGGGCGGAGCGGGGCGGG + Intergenic
1138503364 16:57462882-57462904 GGGCGGGGGTGTAGTGGGGTGGG + Intronic
1142299404 16:89247690-89247712 GGGCGCCGGGGGCGTGGCGCGGG + Intergenic
1203062391 16_KI270728v1_random:987203-987225 GGGCGGGGGCGGAGCGGGGCGGG - Intergenic
1142848140 17:2691948-2691970 GGGCGGGGGCGTGGCGGGGCGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143604984 17:7978262-7978284 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1144804624 17:17956523-17956545 GGGACCGGGCGCAGTGGAGCAGG + Intronic
1145089844 17:19977637-19977659 GGGTGCGGGGGGACTGGCGCGGG + Exonic
1147743154 17:42680008-42680030 GGGGGCGAGCGCCGTGGCGCAGG - Exonic
1147900283 17:43779058-43779080 GAGCGCGGGCGCCGTGACGCGGG + Intergenic
1152103565 17:78316341-78316363 GGGCGAGTGCGTGGTGGAGCAGG + Intergenic
1152197321 17:78925269-78925291 GGGCGCGAGGGGAGGGGCGCGGG + Exonic
1152349683 17:79777912-79777934 GGGGGCGGGGGTGGGGGCGCGGG - Intergenic
1152402462 17:80075758-80075780 GGGGCCGGGCGCAGTGGCTCAGG - Intronic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152581187 17:81166236-81166258 GAGCGCGCGCGGAGCGGCGCGGG + Intergenic
1152729352 17:81961926-81961948 GGGCCCGGCAGCAGTGGCGCCGG + Intergenic
1152923988 17:83079423-83079445 GGGCGCGGGCGCCGGGGCGGGGG - Intergenic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1155041113 18:22066232-22066254 GTGCCTGGGCGTGGTGGCGCGGG + Intergenic
1155427151 18:25718273-25718295 GAGGCCGGGCGTAGTGGCTCAGG - Intergenic
1158521789 18:58177173-58177195 GGGCACGGGCGTGGGGGCACAGG - Intronic
1159870639 18:73756847-73756869 GGGTGCGGGGGTAGTGGAGCTGG + Intergenic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160499790 18:79395996-79396018 GGGCGCGGGCACCGGGGCGCGGG + Intronic
1160592353 18:79951580-79951602 GGGCGCGGGGCTGGGGGCGCAGG - Exonic
1160766870 19:812695-812717 GGGCGCGGCCGATGGGGCGCTGG - Exonic
1161698469 19:5783008-5783030 GGGCCCCGGGGGAGTGGCGCTGG + Exonic
1162470921 19:10871654-10871676 GGGCCCGGGCGCAGCGGCGGCGG + Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165058531 19:33194141-33194163 GGGCGCGGGCGGGGCGGGGCTGG + Intronic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165379380 19:35467490-35467512 GGGGCCGGGCATAGTGGCTCAGG - Intergenic
1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG + Exonic
1166733698 19:45072221-45072243 GGGCGCAGGCGTAGGGACACTGG + Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167624458 19:50578299-50578321 CGGGCCGGGCGTAGTGGCTCAGG + Intergenic
924988132 2:288952-288974 GGGCGCGGGAGACGGGGCGCGGG - Intergenic
926109105 2:10170790-10170812 GGGCGGGGGCGTGGGGGTGCGGG - Intronic
926268142 2:11344530-11344552 GGCGGCGGCCGTAGTGGCCCAGG - Exonic
926539066 2:14152062-14152084 CGGCCCAGGCGTAGTGGCTCAGG - Intergenic
932316899 2:70790588-70790610 GAGCGCGGGCGGCGCGGCGCGGG + Exonic
934966749 2:98730790-98730812 GGGGGCGGGCGGCGGGGCGCGGG - Intronic
935137818 2:100322491-100322513 GGACGCGCGCGCAGTCGCGCAGG - Exonic
936452841 2:112646178-112646200 GGGCGCGGACGCCGTGGCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
947156019 2:227164067-227164089 GGGCGCGGGTGGATTGGGGCTGG - Exonic
947574054 2:231258460-231258482 GGGGCCGGGCGTGGTGGCTCAGG - Intronic
948492226 2:238320848-238320870 GGGCCCGGGCCGGGTGGCGCCGG + Intronic
948801714 2:240436189-240436211 GGGCCCGGGCGGCGGGGCGCAGG - Intronic
949004332 2:241636908-241636930 GGGCGGGGGCGTGGCGGCCCGGG + Intronic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
1170924678 20:20712338-20712360 GGGCGCGGGGGTCGGGGCGCCGG - Intronic
1171023244 20:21606274-21606296 GGGCACGGGGGTAGTGGAGAGGG - Intergenic
1171309528 20:24135176-24135198 GGGTGCGGAGGTGGTGGCGCCGG + Intergenic
1172037321 20:32019165-32019187 GGGCGCGGGCGTCGGGCAGCTGG + Exonic
1174211637 20:48883857-48883879 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1175847304 20:62065549-62065571 GGGCGCGCCCGGAGCGGCGCCGG - Exonic
1175847476 20:62066124-62066146 GGGCGCGGGCGCCGGGGCGGTGG + Intergenic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1176293501 21:5058744-5058766 GGGTGCTGGCGGAGTGGAGCGGG - Intergenic
1179863759 21:44204904-44204926 GGGTGCTGGCGGAGTGGAGCGGG + Intergenic
1180259775 21:46661448-46661470 TGGGGCGGGCGCGGTGGCGCCGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1183745108 22:39687483-39687505 GGGCGGGGGCATAGTTGCTCAGG - Exonic
1183990525 22:41594393-41594415 GGGGGCGGGGGTGGTGGCGGGGG + Intergenic
1184046645 22:41976546-41976568 GGGGACGGGCGGAGGGGCGCAGG - Intronic
1185291493 22:50029969-50029991 GGGGCCGGGCGTGGTGGCTCAGG + Intronic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950087662 3:10272009-10272031 GGGGGCGGGCGCAGTGGCTCAGG - Intronic
951141830 3:19171079-19171101 GGGGCCGGGCGTGGTGGCTCAGG - Intronic
954093103 3:48301163-48301185 GGCCACGGGGGTAGGGGCGCAGG - Intronic
956432181 3:69198130-69198152 GGGGGCGGGCGGAGGGGGGCGGG + Intronic
959539497 3:107523537-107523559 GGGCACGGGCGCCGGGGCGCGGG + Intronic
960223766 3:115146984-115147006 GGGCGCGGGCGGGGCGGGGCGGG + Intronic
962277910 3:134029817-134029839 GGCCGGGCGCGGAGTGGCGCGGG + Exonic
963133119 3:141876552-141876574 CGGCGCGGGCCGAGCGGCGCGGG + Intronic
966187645 3:177242484-177242506 GGGGCCGGGCGTGGTGGCTCAGG - Intergenic
966355190 3:179071963-179071985 GGCCGCGAGCGCAGGGGCGCGGG + Exonic
966593947 3:181710600-181710622 GGGGGCGGGGGTAGGGGCTCAGG - Intergenic
966923194 3:184627847-184627869 GGGGCCGGGCGTGGTGGCTCAGG + Intronic
968691275 4:1991734-1991756 GGGCAGGGGCATGGTGGCGCCGG - Intronic
968908058 4:3463577-3463599 GGGCGCGGGGGTAGCGACACGGG + Intronic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
980588719 4:134855099-134855121 GGGGGCGGGGGTAGTGGGGGCGG + Intergenic
984778545 4:183504739-183504761 GGCCGCGGGCGGAGGGGCGGGGG + Intergenic
985451973 4:190067620-190067642 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985452960 4:190070911-190070933 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985453949 4:190074204-190074226 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985454937 4:190077497-190077519 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985455923 4:190080794-190080816 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985456908 4:190084088-190084110 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985457896 4:190087384-190087406 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985458884 4:190090681-190090703 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985463136 4:190173444-190173466 GGGGGAGGGCGTGGTGGCGGTGG - Intergenic
985727529 5:1523911-1523933 GGGCGCGGGTCTCGGGGCGCGGG + Exonic
985995619 5:3595647-3595669 GGGCGCGCGCGTCGGGGCGGCGG - Intergenic
998034953 5:138907299-138907321 GGGGCCGGGCGTGGTGGCTCAGG - Intronic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1002186198 5:177455946-177455968 CGGCGCGGGCCGAGGGGCGCTGG - Exonic
1002888167 6:1313411-1313433 GGGCGCGGGCGGCGGGGCGGCGG - Exonic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1004043991 6:12009260-12009282 GGGGGCGGGCAGGGTGGCGCGGG + Intronic
1004864159 6:19837366-19837388 GGGCGAGAGCGTAGTGGAGGAGG + Exonic
1006472950 6:34238244-34238266 GCGCGCGGGGGGAGGGGCGCAGG - Intronic
1007600131 6:43076251-43076273 GGGAGGGGGCGTCGTGGGGCGGG + Intronic
1007665276 6:43509884-43509906 GGTCGCGGGCGGAGTGGGGCCGG + Exonic
1019443524 7:1059491-1059513 GGGCGGGTCCGTAGTGGGGCGGG + Intronic
1019481467 7:1268745-1268767 GGACGCGGGCGTGGTGCGGCAGG + Intergenic
1019562534 7:1665780-1665802 GGGCGCGGGCGCAGTGGTGGCGG - Intergenic
1019713230 7:2526808-2526830 GGGAGCGGGCGGAGTGATGCCGG - Intronic
1020278231 7:6637287-6637309 GGGCGCGGGCGGGGCGGGGCCGG + Intergenic
1026850375 7:73719747-73719769 GGGCCCGGGCGGGGTGGGGCGGG - Intergenic
1029686141 7:102149487-102149509 GGGCAATGGCGTAGTGGCGCTGG - Intronic
1029814006 7:103075287-103075309 GGGCGCGGGCTGGGTGGCGGCGG + Exonic
1031986544 7:128167693-128167715 GGGCGCCGGCGAGGTGGCGAGGG + Intergenic
1032221980 7:130001283-130001305 GGGGCCGGGCGTGGTGGCTCAGG - Intergenic
1033050844 7:138002495-138002517 GGGCGCGAGAGTTGTTGCGCGGG + Intronic
1034676343 7:152895155-152895177 GGGGCCGGGCGTGGTGGCTCAGG + Intergenic
1035127150 7:156616792-156616814 GAGCCCGGGCGCAGGGGCGCGGG - Intergenic
1035552904 8:544270-544292 CGGCGCGGGCGTCGTGGGCCCGG - Intronic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1037825302 8:22156823-22156845 GGGCGCGCGCGGGGCGGCGCGGG + Exonic
1040424570 8:47272672-47272694 GGGCACGTGCGTAGTGATGCAGG + Intronic
1041829989 8:62143364-62143386 TGGTGCGGGCGTAGCGGAGCTGG + Intergenic
1044591428 8:93917242-93917264 TGGGGCGGGCGTGGCGGCGCTGG + Intronic
1048766367 8:137848645-137848667 GGGGCCGGGCGTGGTGGCTCTGG + Intergenic
1049417135 8:142500334-142500356 GGGCGGGGGAGGAGCGGCGCGGG - Intronic
1049417156 8:142500380-142500402 GGGCGGGGGAGGAGCGGCGCGGG - Intronic
1049665407 8:143840681-143840703 GGGCGCGGGGGTTGGGGCACGGG - Intronic
1049798044 8:144505506-144505528 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798061 8:144505548-144505570 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798079 8:144505590-144505612 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798097 8:144505632-144505654 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798115 8:144505674-144505696 GGGCGCGGAGGGAGTGGGGCGGG - Intronic
1049798131 8:144505716-144505738 GGGTGCGGGAGGAGTGGGGCGGG - Intronic
1049867882 8:144950653-144950675 GGGCGGGGGCGGAGCCGCGCGGG - Intronic
1053001155 9:34577957-34577979 GGGCGGGGGCGTCGCGGCGGCGG + Intronic
1054899823 9:70357172-70357194 GAGCCCGGGCGTAGTGACTCAGG - Intergenic
1060555316 9:124504831-124504853 GGGCGCGGGGCTGGCGGCGCGGG + Intronic
1060996552 9:127877535-127877557 GGGCGGGGGCGTGCTGGTGCGGG - Intronic
1061852236 9:133423055-133423077 GGGGCCGGGCATAGTGGCTCTGG - Intronic
1062370175 9:136234757-136234779 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1062370197 9:136234834-136234856 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1186417406 X:9395603-9395625 GGGGCCGGGCGTAGTGGCTCAGG - Intergenic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187507178 X:19887362-19887384 GGGCGTGGGGGTTGGGGCGCCGG + Exonic
1187670143 X:21658555-21658577 GGGCGCGGGTGAAGCGGCCCGGG + Intergenic
1189005129 X:36986446-36986468 CGGAGCGGGAGGAGTGGCGCGGG - Intergenic
1189043894 X:37571496-37571518 CGGAGCGGGAGGAGTGGCGCGGG + Intronic
1189433340 X:40969003-40969025 GGGGCCGGGCGTGGTGGCTCAGG - Intergenic
1191955522 X:66639109-66639131 GGGCGGGGGCTGAGGGGCGCGGG - Intronic
1192260745 X:69504768-69504790 GGGCGGGAGCGGAGCGGCGCGGG + Intergenic
1192491060 X:71578000-71578022 GGGCGCGGGGGGAGGGGCGGGGG - Intergenic
1194890440 X:99372098-99372120 GGGACCGGGCGCAGTGGAGCAGG + Intergenic
1198205312 X:134460077-134460099 AGGCGCCGGCGTAGGCGCGCGGG + Intergenic