ID: 1175863352

View in Genome Browser
Species Human (GRCh38)
Location 20:62161726-62161748
Sequence GCGGCCCTGAGCCTGGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 500}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175863352_1175863355 -5 Left 1175863352 20:62161726-62161748 CCATCGCCCAGGCTCAGGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 500
Right 1175863355 20:62161744-62161766 GCCGCAGCGAGCGTGCCGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
1175863352_1175863358 0 Left 1175863352 20:62161726-62161748 CCATCGCCCAGGCTCAGGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 500
Right 1175863358 20:62161749-62161771 AGCGAGCGTGCCGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1175863352_1175863357 -1 Left 1175863352 20:62161726-62161748 CCATCGCCCAGGCTCAGGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 500
Right 1175863357 20:62161748-62161770 CAGCGAGCGTGCCGTGCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175863352 Original CRISPR GCGGCCCTGAGCCTGGGCGA TGG (reversed) Intronic