ID: 1175863927

View in Genome Browser
Species Human (GRCh38)
Location 20:62164478-62164500
Sequence CCGCGTGGAGGCCAGTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175863927_1175863938 16 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863938 20:62164517-62164539 TGAAAGGCTGTGGGAGTTGGAGG 0: 1
1: 0
2: 2
3: 46
4: 440
1175863927_1175863939 19 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863939 20:62164520-62164542 AAGGCTGTGGGAGTTGGAGGCGG 0: 1
1: 0
2: 9
3: 79
4: 1030
1175863927_1175863935 7 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863935 20:62164508-62164530 TCTACTTCCTGAAAGGCTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 169
1175863927_1175863932 0 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863932 20:62164501-62164523 CCTTGCCTCTACTTCCTGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 254
1175863927_1175863936 13 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863936 20:62164514-62164536 TCCTGAAAGGCTGTGGGAGTTGG 0: 1
1: 0
2: 2
3: 35
4: 307
1175863927_1175863934 6 Left 1175863927 20:62164478-62164500 CCGCTGCACTGGCCTCCACGCGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1175863934 20:62164507-62164529 CTCTACTTCCTGAAAGGCTGTGG 0: 1
1: 0
2: 0
3: 39
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175863927 Original CRISPR CCGCGTGGAGGCCAGTGCAG CGG (reversed) Intronic
900229377 1:1548668-1548690 CCATGTGGAAGCCAGGGCAGGGG - Intronic
900313909 1:2047842-2047864 CCCCAGGGAGGCCAGTGCCGAGG + Intergenic
905675600 1:39822689-39822711 CAGCTTGGAGGCCAGTGCAGAGG + Intergenic
906490043 1:46261092-46261114 CAGGGTGGAGGGCAATGCAGGGG + Intronic
908264083 1:62361398-62361420 TCGCCTGGAGCCCAGTGCTGCGG - Intergenic
911793537 1:102047931-102047953 CAGGGTGGAGAGCAGTGCAGTGG - Intergenic
912552059 1:110490772-110490794 GGGAGTGGAGTCCAGTGCAGAGG + Intergenic
920678201 1:208053144-208053166 CTGCCTGGAGGGCAGTGGAGTGG + Intronic
921639445 1:217534635-217534657 CCGGGTGGTGGTGAGTGCAGAGG - Intronic
922606750 1:226894326-226894348 GCCTGTGGAGGACAGTGCAGGGG + Intronic
922614710 1:226954989-226955011 CCTCCTGCAGGCCTGTGCAGAGG - Intronic
924693047 1:246370210-246370232 CCGGGTGGATGACAGTGGAGAGG + Intronic
1067161030 10:43825515-43825537 CTGCCTGGAGGCCAGAGCTGAGG + Intergenic
1067214948 10:44293691-44293713 CTGCCTGGAGGCCAGGGCTGAGG - Intronic
1073316624 10:102585793-102585815 CCACAATGAGGCCAGTGCAGTGG - Intronic
1075748277 10:124743396-124743418 CCGCGGGGAGGCCACCGCTGGGG - Intronic
1077337069 11:2010141-2010163 CTTCGTGAAGGCCAGGGCAGGGG + Intergenic
1079969314 11:27017150-27017172 CAGGGTGGAGGCCAGGGCAATGG - Intergenic
1080056431 11:27911407-27911429 CAGAATAGAGGCCAGTGCAGTGG + Intergenic
1081696174 11:45110596-45110618 CGCCGGGGAGGCCAGAGCAGCGG - Intronic
1081805394 11:45887150-45887172 CCACCTGGAGGCCTCTGCAGTGG + Intronic
1082080152 11:48006492-48006514 CCACGTGGAGGCCAGTGAGCTGG + Intronic
1083327099 11:61878399-61878421 CAGAGTGGAGGCCAGATCAGGGG + Intronic
1083962113 11:66020417-66020439 CAGCGAGGAGGCCAGAGGAGAGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085743859 11:79098431-79098453 CTGAGTGGAGGCCAGTGCACAGG - Intronic
1088522256 11:110712420-110712442 CGGGCTGGAGGCGAGTGCAGCGG + Exonic
1088597723 11:111452424-111452446 CCGCCAGGGGGCCAGTGCTGTGG + Intronic
1202820053 11_KI270721v1_random:65323-65345 CTTCGTGAAGGCCAGGGCAGGGG + Intergenic
1092090291 12:5798404-5798426 CCGCGTGGAGGCCAGAGTTTGGG - Intronic
1095096985 12:38154201-38154223 CCTCGCTGAGGCCAGCGCAGGGG - Intergenic
1097183428 12:57183875-57183897 CCGTGTGGAGGGCATTGCAGTGG + Exonic
1097225804 12:57476272-57476294 CAGCGGGGAGGGCGGTGCAGAGG - Intronic
1098264619 12:68705995-68706017 CCAAGTGGAGGCCCCTGCAGCGG + Intronic
1102259188 12:111433598-111433620 CAGCCTGGAGTGCAGTGCAGTGG + Intronic
1103338895 12:120210742-120210764 CTGCCAGGAGGCCAGTGGAGTGG + Exonic
1103504737 12:121434454-121434476 CAGCCTGGAGTGCAGTGCAGTGG - Intronic
1104842990 12:131833521-131833543 CCCAGAGGAGGCCGGTGCAGGGG + Intronic
1105014994 12:132781220-132781242 CGGAGTGGAGGGCAGTGCGGTGG - Intronic
1106696018 13:32173414-32173436 CAGCGTGGAGTACACTGCAGTGG - Exonic
1112968813 13:105233685-105233707 TCGCTTTGTGGCCAGTGCAGTGG + Intergenic
1113575103 13:111389814-111389836 CCGGGTGGAGGCCAAGGCTGTGG + Intergenic
1113905764 13:113818500-113818522 CAGCGTGGAGGCCTGGGCTGCGG + Intergenic
1114901337 14:27063530-27063552 CCTCTTAGAGGCCAGTGCTGGGG - Intergenic
1115271337 14:31556934-31556956 CCAGGTGGAGCTCAGTGCAGTGG - Intronic
1115557117 14:34552757-34552779 CCGCGTGGCTGCCACTGAAGAGG - Intergenic
1117913862 14:60657310-60657332 GCGCGGGGAGGTCAGTGGAGCGG + Intronic
1118877343 14:69796670-69796692 CTGGGTGGAGGCTAGGGCAGGGG - Intronic
1119312046 14:73655751-73655773 CCTCGTGGAGGTTAGTACAGAGG + Intronic
1121449495 14:93998317-93998339 CCCCGAGGAGGCCAGGACAGGGG + Intergenic
1121465002 14:94110114-94110136 CCAGGTGGAGGCCACAGCAGTGG - Intronic
1122090350 14:99334406-99334428 CAGCGTGGAGCCCAGTGAACGGG + Intergenic
1122283286 14:100636771-100636793 GAGCGTGGAGGCCCGGGCAGTGG - Intergenic
1122737224 14:103849684-103849706 GGGCGTGGAGGCTAGAGCAGTGG - Intergenic
1122798574 14:104218498-104218520 CGCCTTGGAGGGCAGTGCAGAGG + Intergenic
1123450520 15:20356938-20356960 CTGCGGGGGGTCCAGTGCAGTGG + Intergenic
1124180540 15:27469098-27469120 CCCCATGGAGGCTACTGCAGGGG + Intronic
1127517531 15:59710653-59710675 TGGAATGGAGGCCAGTGCAGTGG + Intergenic
1127772897 15:62244929-62244951 CAGCGGGGAGACCAGTGCTGAGG - Intergenic
1128496255 15:68200294-68200316 CAGCCTGGAGGCCAGGGCAGGGG - Intronic
1128547888 15:68579683-68579705 CCCCGAGGAGGCCAGCGGAGGGG + Intronic
1130990130 15:88871182-88871204 CCGAGTGGAAGCATGTGCAGAGG + Intronic
1132391155 15:101439072-101439094 CAGCAAGGAGGGCAGTGCAGTGG + Intronic
1132764997 16:1529873-1529895 GCACGTGGAGTGCAGTGCAGGGG + Intronic
1134717489 16:16364137-16364159 CCCCGTGGTGGTCAGTGCCGCGG + Intergenic
1134957263 16:18388022-18388044 CCCCGTGGTGGTCAGTGCCGCGG - Intergenic
1136253756 16:29024616-29024638 CCTCCTTGAGGCCAGTCCAGGGG + Intergenic
1139596091 16:67959193-67959215 CAGCCAGGAGGCCAGGGCAGAGG + Intronic
1140894233 16:79311066-79311088 CAGAGGGGAGGCCAGTGCTGAGG - Intergenic
1140962092 16:79925541-79925563 CAGGGTGGAGTGCAGTGCAGTGG - Intergenic
1141853558 16:86665223-86665245 CTGCCTGGCGGCCAGTGCTGGGG - Intergenic
1141861386 16:86718814-86718836 CAGCGTGGAGGTCAGGGCACAGG + Intergenic
1142406152 16:89891365-89891387 CAGAGTGGAGGCCAGTGTGGTGG - Intronic
1142529090 17:566587-566609 CGGGATGGAGGCCGGTGCAGTGG + Intronic
1142568953 17:859791-859813 CCCCGTGGAGGACAGGGAAGGGG - Intronic
1144641097 17:16937131-16937153 CAGCGGGGAGGCCAGTGGGGAGG + Intronic
1145344284 17:21979116-21979138 CCGAGTGGAGTGGAGTGCAGTGG + Intergenic
1147783702 17:42962742-42962764 CTGAGTGGAGGCCAGGGCAGTGG + Intronic
1148568377 17:48646977-48646999 CCGCGGGGAGGCCAGAGGCGCGG + Intergenic
1151423819 17:74016604-74016626 CTTCGTAGAGGCCAGTGCTGGGG - Intergenic
1151747252 17:76018185-76018207 CCGCCTGAAGGCCAGTGCTGTGG - Exonic
1151945289 17:77316288-77316310 CGGCTGGGAGGCGAGTGCAGAGG - Intronic
1152337921 17:79708396-79708418 CTGCGGGGGGCCCAGTGCAGTGG - Intergenic
1152596328 17:81239456-81239478 CCGCGGGCGGGCCAGTGCTGCGG + Intronic
1152795900 17:82306096-82306118 CCGCATGCAGGGCAGCGCAGAGG - Intergenic
1160135033 18:76264550-76264572 CAGGGTGGAGGGCAGGGCAGAGG + Intergenic
1160149082 18:76385766-76385788 CCGGGGGGGGGGCAGTGCAGTGG - Intronic
1160231279 18:77051487-77051509 CCCGGAGGAGCCCAGTGCAGAGG - Intronic
1160709829 19:546065-546087 CCGCTTGCGGGCCGGTGCAGTGG - Intronic
1160861703 19:1239979-1240001 CCGTGTTCAGGCCAGTGCAATGG - Intergenic
1161109848 19:2463010-2463032 CCGGGTGGAGGTCAGTGGAATGG - Intergenic
1161459798 19:4389872-4389894 CCACTTGGGGGCCAGGGCAGAGG + Intronic
1161978886 19:7620447-7620469 CTGCGTGGGGGGCAGGGCAGGGG + Intronic
1162380233 19:10327571-10327593 GTGAGCGGAGGCCAGTGCAGAGG - Intronic
1163468536 19:17483758-17483780 CAGCGTGGAGGTCAGTGTGGGGG - Intronic
1164160610 19:22623495-22623517 CCGCGGGGAGCCCAGCCCAGGGG + Intergenic
1165803165 19:38565309-38565331 CCGCGAGGCGGCCACCGCAGTGG + Exonic
927808548 2:26169352-26169374 CAGAGTGGAGCCCACTGCAGAGG + Intergenic
929600847 2:43203793-43203815 TGGCGTGGTGGTCAGTGCAGGGG + Intergenic
931668021 2:64624156-64624178 GAGCAGGGAGGCCAGTGCAGAGG + Intergenic
936394327 2:112109804-112109826 CAGGGTGGAGTGCAGTGCAGTGG + Intronic
937164268 2:119796170-119796192 CAGTGGGGAGGCCAGAGCAGTGG - Intronic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
947663820 2:231890382-231890404 AGGCCTGGAAGCCAGTGCAGGGG + Intergenic
948420883 2:237859498-237859520 CCGCGTGGGTGCCAGGGCCGGGG - Intronic
948423577 2:237874923-237874945 CCTCTTGGAGGACAGGGCAGCGG + Intronic
948563489 2:238868833-238868855 CTGCGTGCCGGCCGGTGCAGGGG + Intronic
948612921 2:239180997-239181019 TCGCTTGGAGTCCAGGGCAGTGG + Intronic
948823748 2:240564346-240564368 CAGTGTGGAGGCGAGTGCACTGG - Intronic
949067838 2:242004134-242004156 CCCCATGGAGGGCAGTGCCGAGG - Intergenic
1169252140 20:4068963-4068985 CAGCATGGAGGGCAGTCCAGAGG + Intergenic
1169334972 20:4748595-4748617 CAGGCTGGAGGCCAGTGCAGAGG - Intergenic
1172220723 20:33273084-33273106 CTGGGGGGAGGCCAGGGCAGTGG + Intergenic
1172980952 20:38941212-38941234 CTGAGGAGAGGCCAGTGCAGTGG + Intronic
1173850082 20:46212294-46212316 CCACTTGTGGGCCAGTGCAGGGG + Intronic
1174206723 20:48845792-48845814 CCGCGAGGAGGCCAGTGAGGTGG + Intergenic
1174789236 20:53462440-53462462 CAGCGTGGAGGCCAGTGTTGTGG - Intronic
1175519551 20:59591345-59591367 CCGGGTGGAGACCTGTGAAGTGG - Intronic
1175863927 20:62164478-62164500 CCGCGTGGAGGCCAGTGCAGCGG - Intronic
1176062443 20:63178379-63178401 CCGCGTGGCGGGCAGGGCGGGGG - Intergenic
1176273971 20:64253191-64253213 CTGTGAGGAGGCCAGGGCAGAGG + Intergenic
1179247261 21:39644838-39644860 CCCTGGGGAGGCCAGTGCTGGGG - Intronic
1181048426 22:20227492-20227514 AAGCCTGGAGGCCAGTGCAGGGG + Intergenic
1182304194 22:29356598-29356620 CCAGGTGGTGGCCAATGCAGTGG - Exonic
1182355959 22:29722290-29722312 CCGCAGGGTGGGCAGTGCAGGGG + Intronic
1182655262 22:31885049-31885071 AAGCCAGGAGGCCAGTGCAGAGG - Intronic
1184798083 22:46743329-46743351 CCGCCTGAAGGCATGTGCAGAGG + Intergenic
1184865322 22:47198987-47199009 CTCCGTGGACGCCAGTGCCGTGG + Intergenic
1185344942 22:50307049-50307071 CCGCGAGGAGGCCCAGGCAGTGG + Intronic
1185351820 22:50343488-50343510 CCGTGTGGAGGCCCGAGCGGAGG - Exonic
949537843 3:5009688-5009710 CCTGAGGGAGGCCAGTGCAGAGG + Intergenic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
950474631 3:13207611-13207633 CCTCAGGGAGGCCAGGGCAGAGG - Intergenic
953465075 3:43112721-43112743 GCGTGTGGAGGCCAGTTCATGGG - Intergenic
953772260 3:45786991-45787013 CTGCCTGGAGGGCGGTGCAGTGG - Intronic
953999277 3:47543097-47543119 CCCCGGGGAGGCCTGTGCCGAGG - Intergenic
955395654 3:58555487-58555509 CCCCTTGGTGGCAAGTGCAGAGG - Intergenic
960941499 3:122937923-122937945 CCTGGGGGAAGCCAGTGCAGAGG - Intronic
961390081 3:126547327-126547349 CCGCATGGAAGCCCTTGCAGAGG - Intronic
968701459 4:2059940-2059962 CCGCGTGGACGCCGGGGCGGGGG - Intronic
976830267 4:89307568-89307590 CCGCCTGGCGGCCAGCGCGGGGG - Intronic
980930013 4:139176536-139176558 CCGCGGGGAGGCCAGGGCGGGGG - Intronic
981744038 4:148034614-148034636 CCAGATGGAGGCCAGGGCAGTGG - Intronic
982739169 4:159039845-159039867 CAACTTGGAGGCCAATGCAGTGG + Intergenic
985385858 4:189447672-189447694 AGGCCTGGAGGCCAGTGAAGGGG - Intergenic
991484372 5:67119311-67119333 CCATGTGGAAGCCAGTTCAGAGG + Intronic
992473217 5:77077626-77077648 CCGCGTGGAAGCCCGGGCCGCGG + Exonic
995354222 5:111219674-111219696 CTGAGGGGAGGCCAGGGCAGGGG - Intergenic
995372093 5:111429731-111429753 CAGCCTGGAGTGCAGTGCAGTGG - Intronic
997120170 5:131165219-131165241 CCGCGCGGCGGCCAGAGGAGAGG + Exonic
997413160 5:133705465-133705487 CCTGGTGGACGCCAGAGCAGAGG - Intergenic
997536712 5:134628097-134628119 CCGGCTGGAGTGCAGTGCAGTGG - Intronic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
999255574 5:150208389-150208411 CAGCATGGAGGCCAGTGCTGCGG + Intronic
999727283 5:154446856-154446878 CCGACTGGAGCCCAGGGCAGCGG - Intronic
999748097 5:154607456-154607478 CCACCTGGAGGTCAGAGCAGCGG - Intergenic
1004608567 6:17216970-17216992 CCGACTGGAGTGCAGTGCAGTGG - Intergenic
1006321155 6:33320318-33320340 CTCCCTGGTGGCCAGTGCAGGGG + Intronic
1008535912 6:52505984-52506006 CCGCTTAGAGGCCTGGGCAGGGG - Intronic
1013562475 6:111319419-111319441 CAGGCTGGAGTCCAGTGCAGTGG - Intronic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1017455537 6:154597769-154597791 CCGTGTGTAGGACAGAGCAGGGG + Intergenic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018945287 6:168343620-168343642 CAGGGTGAAGGCAAGTGCAGAGG - Intergenic
1019019878 6:168909747-168909769 CGTCGTGGAGGCCAGGTCAGTGG + Intergenic
1019019888 6:168909801-168909823 CGTCGTGGAGGCCAGGTCAGTGG + Intergenic
1019019898 6:168909855-168909877 CGTCGTGGAGGCCAGGTCAGTGG + Intergenic
1019019908 6:168909909-168909931 CGTCGTGGAGGCCAGGTCAGTGG + Intergenic
1019019918 6:168909963-168909985 CGTCGTGGAGGCCAGGTCAGTGG + Intergenic
1019019928 6:168910017-168910039 CATCGTGGAGGCCAGGTCAGTGG + Intergenic
1019143528 6:169962651-169962673 GCGCGGGGAGGCCAGTGGAGAGG + Intergenic
1019304677 7:327617-327639 CACCCTGGAGGCCAGGGCAGGGG - Intergenic
1019326204 7:439519-439541 CCTCGTGGAGGGCAGGGCTGTGG - Intergenic
1019621066 7:1992217-1992239 CAGCGTGGAAGTCAGAGCAGTGG - Intronic
1022067254 7:26871947-26871969 GCTCTTTGAGGCCAGTGCAGTGG + Intronic
1024689666 7:51785705-51785727 AGGTGTGGAGGCCAGTGCAGTGG - Intergenic
1028477448 7:91266617-91266639 CCGCCTGGAGGTGAGGGCAGGGG - Exonic
1030093987 7:105881525-105881547 CAGGGTGGAGGCCAGAGCATAGG + Intronic
1031382518 7:121105049-121105071 TCCCCTGAAGGCCAGTGCAGCGG - Intronic
1033358132 7:140617435-140617457 CATCTTGAAGGCCAGTGCAGTGG + Intronic
1033597512 7:142867844-142867866 CCACGTGGGGCCCAGGGCAGGGG - Intronic
1034497719 7:151432282-151432304 CCACCTGGAGGCCAGGGGAGTGG + Intronic
1035823092 8:2616079-2616101 CAGCGGGGGGGACAGTGCAGAGG + Intergenic
1035877343 8:3205596-3205618 CCCTGTGGAGGCCAGTACACGGG - Exonic
1036548915 8:9799730-9799752 CCACAAGGAGGCCAGGGCAGGGG + Intergenic
1038643666 8:29347210-29347232 ATGCCTGGAAGCCAGTGCAGTGG - Intronic
1038710284 8:29937796-29937818 CAGAGTGGACGCCAGTGAAGCGG - Intergenic
1040579954 8:48689563-48689585 CCAGGTGGTGGCCAGTGCAGGGG - Intergenic
1041473184 8:58233901-58233923 CTGTGAGGAGGCCATTGCAGGGG + Intergenic
1050294952 9:4195576-4195598 CCGCGTGGGAGCCCGTGGAGGGG - Intronic
1053493782 9:38533578-38533600 AAGCGTGGAGGTCAGGGCAGAGG - Intergenic
1055574416 9:77647588-77647610 CCGCGCGGGTGCCAGTGGAGAGG + Intronic
1058887166 9:109330286-109330308 GCAGGAGGAGGCCAGTGCAGTGG - Intergenic
1059197326 9:112382218-112382240 CAGGGTGGAGGGCAGGGCAGTGG - Intronic
1061498262 9:130987955-130987977 CGGCGTGGAGGCGAGTATAGGGG + Intergenic
1061817467 9:133205608-133205630 CCGCGTGGGGACAGGTGCAGGGG + Exonic
1189037284 X:37505900-37505922 CCGCGTGGTGGCGCGAGCAGGGG - Intronic
1189749977 X:44211238-44211260 CAGTTTGGAGGCCAGGGCAGTGG + Intronic
1192198795 X:69050413-69050435 CTGTGTGGAGGCCATTGCTGGGG - Intergenic
1192290936 X:69794629-69794651 ATGCGTGGAGACCAGTGAAGAGG + Intronic
1200239128 X:154484653-154484675 CCACAGGGAGGCCAGTGCTGGGG + Exonic
1201113523 Y:10818558-10818580 TAGAGTGGAGGCGAGTGCAGTGG - Intergenic
1201124592 Y:10901526-10901548 CTGAGTGGAGTCGAGTGCAGTGG - Intergenic