ID: 1175866690

View in Genome Browser
Species Human (GRCh38)
Location 20:62182609-62182631
Sequence CCTTGCCGCCGCGGGGAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175866690_1175866705 14 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866705 20:62182646-62182668 GGGCGGTGGGGACGGCGCCCCGG 0: 1
1: 0
2: 8
3: 57
4: 561
1175866690_1175866700 0 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866700 20:62182632-62182654 CGAAGCCAGGGTAAGGGCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 166
1175866690_1175866708 27 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866708 20:62182659-62182681 GGCGCCCCGGGGCTGCCCTGCGG 0: 1
1: 0
2: 4
3: 51
4: 395
1175866690_1175866702 2 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866702 20:62182634-62182656 AAGCCAGGGTAAGGGCGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 243
1175866690_1175866699 -3 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866699 20:62182629-62182651 AGGCGAAGCCAGGGTAAGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 396
1175866690_1175866697 -7 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866697 20:62182625-62182647 GGCAAGGCGAAGCCAGGGTAAGG 0: 1
1: 0
2: 2
3: 31
4: 340
1175866690_1175866707 16 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866707 20:62182648-62182670 GCGGTGGGGACGGCGCCCCGGGG 0: 1
1: 0
2: 2
3: 20
4: 211
1175866690_1175866704 6 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866704 20:62182638-62182660 CAGGGTAAGGGCGGTGGGGACGG 0: 1
1: 0
2: 3
3: 58
4: 665
1175866690_1175866701 1 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866701 20:62182633-62182655 GAAGCCAGGGTAAGGGCGGTGGG 0: 1
1: 0
2: 2
3: 19
4: 215
1175866690_1175866706 15 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866706 20:62182647-62182669 GGCGGTGGGGACGGCGCCCCGGG 0: 1
1: 0
2: 5
3: 42
4: 443
1175866690_1175866698 -6 Left 1175866690 20:62182609-62182631 CCGGATTCCCCGCGGCGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1175866698 20:62182626-62182648 GCAAGGCGAAGCCAGGGTAAGGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175866690 Original CRISPR CCTTGCCGCCGCGGGGAATC CGG (reversed) Intergenic
901057803 1:6456886-6456908 ACCTGCCTCTGCGGGGAATCAGG + Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
922975672 1:229781582-229781604 GCTTGCAGCTGCGTGGAATCCGG + Intergenic
1065588250 10:27240894-27240916 CCTTGCCGCGGCGGCGGGTCGGG - Intronic
1067363182 10:45600848-45600870 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
1069992962 10:72326060-72326082 CCCTGCCGCCCCGGGGAATGAGG + Intergenic
1075520831 10:123142722-123142744 CCTTGCGCCCGCGGGGCACCTGG + Intergenic
1081528429 11:43942620-43942642 CCTGGCCGCCGCGGGGCAGACGG + Exonic
1081851711 11:46278699-46278721 CCTGGCAGCCCCAGGGAATCAGG + Intronic
1083032697 11:59608248-59608270 CTTTGCTGCAGCTGGGAATCAGG - Intronic
1084474421 11:69380757-69380779 CCCTGCAGCCGCCGGGAAGCTGG - Intergenic
1085205913 11:74731680-74731702 TCTTGGCGTCGCGGGGAGTCAGG - Intergenic
1090776733 11:129972075-129972097 CCTTGCCGCCCCGGGCAGTGAGG - Intronic
1092430445 12:8404380-8404402 CCTTGCCGGCCCGGGCAATGAGG + Intergenic
1102099509 12:110267513-110267535 CCTTGCCACAGCGGGGAGTAGGG + Intergenic
1107836103 13:44413681-44413703 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
1110940305 13:81341025-81341047 CCCTGCCGCCCCGGGCAATGAGG - Intergenic
1111132590 13:83996512-83996534 CCTTGTCGCTTCTGGGAATCAGG + Intergenic
1112046674 13:95604336-95604358 CCCTGCCGCCCTGGGGAAGCTGG + Intronic
1113047095 13:106167942-106167964 CCTTGAGGCCGAAGGGAATCTGG - Intergenic
1119860028 14:77929595-77929617 CCTGGCCCCAGCAGGGAATCTGG - Intronic
1127766075 15:62186817-62186839 CCCTGCCGCCCCGGGCAATGAGG - Intergenic
1132830312 16:1924781-1924803 CCTTCCCGATGCTGGGAATCTGG - Intergenic
1134081420 16:11327513-11327535 CCTGGCCGCCGCGTGGAGACTGG - Intronic
1137288891 16:47038139-47038161 CCTGGACGCCGCTGGGAGTCGGG - Intergenic
1138693611 16:58791023-58791045 CCCTGCCGCCGCGGGCAATGAGG - Intergenic
1148090076 17:45018295-45018317 CCTTGTGGCAGGGGGGAATCAGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1156038659 18:32794681-32794703 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
1160891940 19:1383739-1383761 CCTTTCCGCCTCGGGTGATCTGG + Exonic
1162591956 19:11597743-11597765 CCTTGCGGCCGAGGGAACTCGGG - Intronic
1163714646 19:18866691-18866713 CCTCGCCGCCGCGGGCCAGCAGG - Exonic
1166677535 19:44748795-44748817 CATGGCCCCCGCGGGGCATCGGG - Exonic
931853705 2:66279774-66279796 CCTTGCCTTAGCGGGCAATCAGG - Intergenic
933792058 2:85890718-85890740 CTTTGCCGACAAGGGGAATCTGG - Intergenic
935595171 2:104872554-104872576 CCTGGCCGCCGCGGGAACTCGGG - Intergenic
936433021 2:112481229-112481251 CCTGGCGGCCCCGTGGAATCTGG + Intergenic
942278133 2:174337087-174337109 CCTTGCCGCAGCCCGGAATGTGG - Exonic
944676750 2:202039399-202039421 CCTGGCAGCCGTGGGGACTCAGG + Intergenic
947641709 2:231710691-231710713 CCTAGCCGCCGCGGGGAGGCCGG + Intronic
949023570 2:241754523-241754545 CCTCGCCACCACTGGGAATCCGG - Intronic
1172240184 20:33408039-33408061 CCCTGCCACCGTGGGGAGTCTGG - Exonic
1172832359 20:37846658-37846680 CCTTGCAGCAGCAGGGAATCAGG - Intronic
1175847596 20:62066483-62066505 CCAAGCCGCCGCGGGGAAGCTGG + Intergenic
1175866690 20:62182609-62182631 CCTTGCCGCCGCGGGGAATCCGG - Intergenic
1177637609 21:23807123-23807145 CCCTGCCGGCCCGGGGAATGAGG + Intergenic
1183427348 22:37746770-37746792 CCTGGCCGCCTTGGGGAATCGGG - Intronic
1184173617 22:42773350-42773372 CCTGGCAGCGGCGGGGAACCAGG + Intergenic
951558846 3:23945992-23946014 CCCTGCGGCCCCGGGGAATGTGG - Intronic
964037530 3:152217409-152217431 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
968831332 4:2934260-2934282 ACTTGAAGCCGCGGGGAACCCGG + Exonic
978080240 4:104582089-104582111 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
993822026 5:92631440-92631462 CCCTGCCGCCCCGGGCAATGGGG + Intergenic
1010703400 6:79078103-79078125 CCCCGCCGCCGAGGGGAAGCGGG + Exonic
1012624921 6:101393548-101393570 CCTGGCCGCCGCGGCCACTCGGG - Intergenic
1016590223 6:145735529-145735551 CCTGCCGGCCGCGGGGACTCCGG - Exonic
1019171825 6:170137088-170137110 CCTTGCCGAGGCCGGGATTCCGG + Intergenic
1028778313 7:94705601-94705623 CCCTGCCGCCCCGGGCAATGAGG + Intergenic
1037822512 8:22141762-22141784 CCTTTCTGCCGCGGAGAACCTGG + Exonic
1037855424 8:22367699-22367721 CCGTGTCCGCGCGGGGAATCCGG - Intronic
1038571564 8:28667052-28667074 CCTTGCCGCCCCAGAGGATCTGG - Intronic
1045467774 8:102485765-102485787 CCCTGCCGCCCCGGGCAATGAGG - Intergenic
1049854562 8:144853153-144853175 CCTCCCCGCCCGGGGGAATCGGG + Intronic
1055049347 9:71963646-71963668 CCCTGCCGCCCCGGGCAATGAGG + Intronic
1057757897 9:97852324-97852346 CCTTCCCGCAGCGGGGAGTGAGG - Intergenic
1190301934 X:49062139-49062161 CCATGCCACAGCGGGGAATAAGG - Intronic
1197376815 X:125690834-125690856 CCCTGCCGCCCCGGGCAATGAGG - Intergenic