ID: 1175867665

View in Genome Browser
Species Human (GRCh38)
Location 20:62189479-62189501
Sequence AAGACTCCTGTCTCTACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175867665_1175867667 -4 Left 1175867665 20:62189479-62189501 CCTTTGGTAGAGACAGGAGTCTT 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1175867667 20:62189498-62189520 TCTTGCTATTTTGCCGAGGCTGG 0: 2
1: 185
2: 8043
3: 45743
4: 114579
1175867665_1175867666 -8 Left 1175867665 20:62189479-62189501 CCTTTGGTAGAGACAGGAGTCTT 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1175867666 20:62189494-62189516 GGAGTCTTGCTATTTTGCCGAGG 0: 1
1: 19
2: 1044
3: 16807
4: 59598
1175867665_1175867669 10 Left 1175867665 20:62189479-62189501 CCTTTGGTAGAGACAGGAGTCTT 0: 1
1: 0
2: 0
3: 17
4: 155
Right 1175867669 20:62189512-62189534 CGAGGCTGGTCTCGAACTCATGG 0: 1
1: 179
2: 12282
3: 62221
4: 71345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175867665 Original CRISPR AAGACTCCTGTCTCTACCAA AGG (reversed) Intronic
901434153 1:9235786-9235808 GAGACCACTGTCTCTACAAAAGG - Intronic
902115682 1:14119063-14119085 CAGAATCCTGGCTCTAGCAAAGG - Intergenic
903588456 1:24436262-24436284 AAGCCTCCTCTCACTACCAAAGG - Intronic
904226878 1:29028623-29028645 AAGTCTGCTGTCTCAACTAAGGG + Intronic
906531162 1:46524864-46524886 CAGCCTCCTGTCTCTTCCAGAGG + Intergenic
907923205 1:58931990-58932012 ATAACTCCTGGCTCTTCCAAAGG + Intergenic
910393900 1:86772676-86772698 AATACTCCTGTCTCTATAGAGGG - Intergenic
913259901 1:116988533-116988555 AACACTGCTCTCTCTTCCAAAGG + Exonic
913956911 1:143308781-143308803 TAAACTCCTGTGTCTACAAATGG + Intergenic
913980530 1:143506871-143506893 TAAACTCCTGTGTCTACAAATGG - Intergenic
914074889 1:144333300-144333322 TAAACTCCTGTGTCTACAAATGG - Intergenic
914104289 1:144633193-144633215 TAAACTCCTGTGTCTACAAATGG + Intergenic
915578503 1:156797952-156797974 AAGACCCCTGTCTCCAAAAAGGG - Intronic
916262642 1:162857695-162857717 AAGGTTCCTGTGTCTATCAAAGG - Intronic
918404134 1:184194677-184194699 AATACTGCTGTATCTGCCAAAGG - Intergenic
921746718 1:218749079-218749101 AAGATTCCTGTCTCTTTTAAGGG + Intergenic
922985196 1:229860869-229860891 TAAACTCCTGCCTCTACCATTGG - Intergenic
923038287 1:230300887-230300909 CAGACTCCCGTCTCTCCCAGGGG + Intergenic
1065385090 10:25126153-25126175 AAGCCCCCTGTTTCCACCAAAGG - Intergenic
1065430078 10:25645014-25645036 AAGAATCCTTCCTCTACAAATGG - Intergenic
1066567746 10:36737978-36738000 AATTCTCCTGTCTCAACCAATGG - Intergenic
1066781265 10:38948479-38948501 TAAACTCCTGTGTCTACAAATGG - Intergenic
1069124931 10:64618727-64618749 AAGACTCCTCTTTCTAGCCAAGG + Intergenic
1070384194 10:75909356-75909378 GAGGCTCCTGTTTCTACTAAAGG - Intronic
1070783178 10:79149113-79149135 AGGTCTCCTGCCTGTACCAAAGG - Intronic
1071513521 10:86282242-86282264 AAGCCTCCTGCCTCTACCTTTGG - Intronic
1071756057 10:88541669-88541691 AAGACAGTTGACTCTACCAATGG + Intronic
1072654783 10:97322330-97322352 AAGACTCCTGTCTTTGCCCCTGG + Intergenic
1074451102 10:113560263-113560285 AAGATTCCTGTGCCTACGAAGGG + Intronic
1074969018 10:118520431-118520453 AAGGCTCCTTTTTCTACAAAAGG - Intergenic
1075048051 10:119161660-119161682 AAAAGTCCTGTCTCTACCCTTGG + Intronic
1075553402 10:123411102-123411124 CTGAATCCTCTCTCTACCAAAGG + Intergenic
1079120273 11:17678435-17678457 AACACTTCTGACTCTACCAAGGG - Intergenic
1079368221 11:19827941-19827963 CGGAATCCCGTCTCTACCAAGGG + Intronic
1081018851 11:37917434-37917456 AAGACTTCTGTCTCCTCCAGTGG + Intergenic
1082721204 11:56679325-56679347 AAGACTCCCCTCTCTGCCCAGGG - Intergenic
1082851009 11:57764831-57764853 AACACTCCTGCCTCTAGCAAGGG - Intronic
1086421380 11:86640839-86640861 AAGTCTCCTGTGTATATCAATGG - Intronic
1086450339 11:86909313-86909335 AACATTCCTGTCTCTCCCATGGG + Intronic
1089004688 11:115081587-115081609 AAGAGGCCTGTCTCTCTCAATGG + Intergenic
1091102534 11:132888264-132888286 ATGATTCCTGTCTGTCCCAAAGG - Intronic
1091611934 12:2017941-2017963 AATACTATTGTGTCTACCAATGG + Intronic
1097611616 12:61830098-61830120 AACCCACCTGTATCTACCAATGG + Intronic
1099486133 12:83231879-83231901 AAAACTCCTCTCTCCTCCAAAGG - Intergenic
1101413322 12:104487037-104487059 AAGTCTACTGTATCGACCAAAGG - Intronic
1102823809 12:115929300-115929322 AAGACACCTGTCTCTAAAAAGGG + Intergenic
1105246171 13:18652391-18652413 AAGACCACTGCCTCTACGAATGG - Intergenic
1105963092 13:25360025-25360047 AAGACTCATGTCTCCAACAACGG - Intergenic
1106928395 13:34636836-34636858 TAGACTCCTGTCTCCACAACAGG - Intergenic
1107520761 13:41178479-41178501 AACAATGCTTTCTCTACCAAAGG - Intergenic
1109728637 13:66380312-66380334 AAAACTGCTGTCAATACCAATGG + Intronic
1112579981 13:100670116-100670138 GAGGCTCCTGTCTTTACTAAGGG + Intronic
1114921094 14:27329954-27329976 AAGACCCCCATCTCTACAAAAGG + Intergenic
1116212263 14:41963400-41963422 AAGACTCATGTCCCTATAAAAGG - Intergenic
1119872214 14:78027660-78027682 AAGACTCCTGGATTCACCAAGGG + Intergenic
1119911978 14:78357715-78357737 AAGAATTCTGTTTTTACCAAAGG + Intronic
1125713810 15:41807577-41807599 CAGACTCCTCTCTCCAGCAAAGG - Intronic
1126655395 15:50971993-50972015 AAGAAACATGTCACTACCAAAGG - Intronic
1126666114 15:51077568-51077590 CTGTCTCCTGTCTCTATCAAAGG - Intronic
1127905151 15:63370924-63370946 AGGGCTCTTGTCTCTATCAAAGG - Intronic
1129314198 15:74731355-74731377 ATGACTCCCATCTCTACCATGGG - Intergenic
1133346334 16:5073119-5073141 AAAACACCTGTGACTACCAAAGG - Intronic
1135878442 16:26227981-26228003 AAGACTCCAGGCTCTTCTAAGGG + Intergenic
1136699839 16:32123719-32123741 TAAACTCCTGTGTCTACAAATGG - Intergenic
1136767815 16:32803766-32803788 TAAACTCCTGTGTCTACAAATGG + Intergenic
1136800334 16:33066931-33066953 TAAACTCCTGTGTCTACAAATGG - Intergenic
1136902722 16:34057280-34057302 TAAACTCCTGTGTCTATCAATGG - Intergenic
1137299752 16:47137442-47137464 ATGTCTCCTGCCACTACCAAAGG - Intronic
1142242598 16:88954403-88954425 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242633 16:88954517-88954539 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242642 16:88954555-88954577 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242659 16:88954612-88954634 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242668 16:88954650-88954672 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242685 16:88954707-88954729 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242701 16:88954764-88954786 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242736 16:88954878-88954900 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242778 16:88955011-88955033 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242787 16:88955049-88955071 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242803 16:88955106-88955128 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242838 16:88955220-88955242 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242881 16:88955353-88955375 AAGGCTCCTGACTCCACCCAAGG + Intronic
1142242890 16:88955391-88955413 AAGGCTCCTGACCCTACCCAAGG + Intronic
1142242906 16:88955448-88955470 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242967 16:88955619-88955641 AAGGCTCCTGACCCTACCCAAGG + Intronic
1203070207 16_KI270728v1_random:1065788-1065810 TAAACTCCTGTGTCTACAAATGG + Intergenic
1144963615 17:19061491-19061513 CGGAATCCCGTCTCTACCAAGGG - Intergenic
1144964063 17:19064535-19064557 CGGAATCCCGTCTCTACCAAGGG + Intergenic
1144971544 17:19113035-19113057 CGGAATCCCGTCTCTACCAAGGG + Intergenic
1144983891 17:19187595-19187617 CGGAATCCCGTCTCTACCAAGGG - Intergenic
1144984334 17:19190644-19190666 CGGAATCCCGTCTCTACCAAGGG + Intergenic
1145710508 17:26968908-26968930 TAAACTCCTGTGTCTACAAATGG - Intergenic
1152866667 17:82727788-82727810 AAGACTCCTGGATGTACCCAAGG - Exonic
1154517313 18:15186531-15186553 TAAACTCCTGTGTCTACAAATGG + Intergenic
1156808433 18:41216733-41216755 AAGACTCCAGTATGTACCACTGG + Intergenic
1157637761 18:49177817-49177839 ATGCCTCCTGTATATACCAATGG + Intronic
1158164158 18:54520124-54520146 GAGACTCCTGTCCTTACCAGAGG + Intergenic
925794408 2:7526892-7526914 AGGACTCCTGCCTCTTCCCAGGG + Intergenic
925811981 2:7710029-7710051 AAGAAAGCTGTCTCTACCATGGG - Intergenic
926829030 2:16940143-16940165 AAGGCTCCTCTCCCTGCCAAGGG + Intergenic
927650496 2:24910370-24910392 AAAACTCTTGTCTCTACAAATGG - Intronic
927923729 2:26994411-26994433 AATTCTCCTCTCTCTACCAGAGG + Intronic
928291615 2:30043240-30043262 ATGATTCCTGTTTCTACAAATGG - Intergenic
928327816 2:30333979-30334001 AAGACTCTTGGCTCTATCCAAGG - Intergenic
929708864 2:44245822-44245844 AAAACTCCTGTCTCTGCCTATGG + Intergenic
936109420 2:109652708-109652730 AAGACTTCAGTCTCTACCAGAGG + Intergenic
941873749 2:170412462-170412484 AAGACTCAGGTCTCTTCCATGGG + Intronic
942687935 2:178553642-178553664 TGGACTACTGTCTCTACCAAAGG - Exonic
947181383 2:227414488-227414510 GAGATTCCCGTCTCTACAAAAGG - Intergenic
947812174 2:233011446-233011468 AAGCCTGCTGGCTCTACCAGGGG - Intronic
948161215 2:235826455-235826477 AAGACTCTTGTCTCAAAAAAAGG - Intronic
948383939 2:237570017-237570039 AAGAGATCTGTCTCTACCACAGG - Intergenic
1171246151 20:23611335-23611357 AAGACTCCAGCCTCTACAAATGG - Intergenic
1172724677 20:37029230-37029252 AAATCTCCTGTGTATACCAAGGG - Intronic
1173450427 20:43158787-43158809 AAGAATCTTGGCTCTACCAATGG + Intronic
1173785501 20:45790166-45790188 AAAATTCCTGGCACTACCAAAGG + Intronic
1174044895 20:47726525-47726547 AAGAGTCCTTTCTGTGCCAATGG + Intronic
1174900910 20:54499190-54499212 AATCCTCCTCTCTCTCCCAAGGG - Intronic
1175867665 20:62189479-62189501 AAGACTCCTGTCTCTACCAAAGG - Intronic
1176583875 21:8556765-8556787 TAAACTCCTGTGTCTACAAATGG - Intergenic
1180266685 22:10533677-10533699 TAAACTCCTGTGTCTACAAATGG - Intergenic
1181053627 22:20249126-20249148 GAGAATCCTGTCTCCACCAAGGG + Intronic
1203288691 22_KI270735v1_random:11745-11767 TAAACTCCTGTGTCTACAAATGG + Intergenic
949840954 3:8319387-8319409 AAGTCTTCTGTCTCTATGAATGG + Intergenic
954164406 3:48744694-48744716 GAGACACCTGCCTGTACCAAAGG - Intronic
956768283 3:72502965-72502987 GAGCCTCCTGTCTCTAAAAAAGG + Intergenic
957279401 3:78130248-78130270 TAGACTTCTGCCTTTACCAAAGG + Intergenic
959040388 3:101415431-101415453 AAAACCCCTTTCTCTTCCAAGGG - Intronic
960121982 3:113956440-113956462 GACACTTCTGTCTCTACAAATGG - Exonic
962774519 3:138646717-138646739 AAGAATCCTGTGTCCAGCAAAGG - Intergenic
963427811 3:145154724-145154746 AAATCTCCTGTCTCTACCTAAGG - Intergenic
964960275 3:162414064-162414086 AAGACTCCGTTCTCCACAAAAGG + Intergenic
965196812 3:165608984-165609006 GAGACTCCTGGCTATGCCAAAGG + Intergenic
966128670 3:176609734-176609756 AAAACTCCTGTATTTACAAAGGG + Intergenic
969265172 4:6059694-6059716 CACACTCCTGTTTCTCCCAAGGG - Intronic
972501354 4:39680912-39680934 AAGTCTGCTGTCTCTAACCAAGG - Intergenic
972781233 4:42288551-42288573 ATGCCTCCTTTCCCTACCAAAGG - Intergenic
972841830 4:42939929-42939951 AATACTTCTGTCTCAACTAAGGG - Intronic
975208843 4:71675819-71675841 AAGAGTTCTGGCTATACCAATGG + Intergenic
975251064 4:72178170-72178192 AAAACTGCCGTCTCTTCCAAAGG - Intergenic
978972121 4:114821388-114821410 AAAGCTCCTGGCTGTACCAAAGG + Intergenic
979438553 4:120723212-120723234 AAGAATCCTGACTCTAAAAATGG + Intronic
983128513 4:163984709-163984731 AAGACATCTGTCTCTTACAAGGG - Intronic
988100713 5:26673698-26673720 AAGATTCCTATCTCTAGCCAGGG - Intergenic
995738913 5:115333722-115333744 AAGCCTGTTCTCTCTACCAAAGG - Intergenic
1000760493 5:165217917-165217939 AAGACTCACGTCTCCAACAACGG + Intergenic
1004441091 6:15655299-15655321 GAGACCCCTGTCTCTACAAAGGG - Intronic
1008122594 6:47635114-47635136 AAGACTCACGTCTCTAAAAACGG - Intergenic
1011971574 6:93230921-93230943 AAGCCTTCTGTCTCCACCAATGG - Intergenic
1017649811 6:156570543-156570565 CAGACTCCTGCCTCTACTCAGGG - Intergenic
1022333622 7:29402202-29402224 ATGATCCCTGTCTCCACCAACGG - Intronic
1023123912 7:36936239-36936261 GAGACCCCTGTCTCTTCCATGGG + Intronic
1024807942 7:53168946-53168968 TAAACTCCTGTGTCTACAAATGG + Intergenic
1025482436 7:60999075-60999097 TAAACTCCTGTGTCTACAAATGG - Intergenic
1025562556 7:62386909-62386931 TAAACTCCTGTGTCTACAAATGG - Intergenic
1025840968 7:65148577-65148599 TAAACTCCTGTGTCTACAAATGG - Intergenic
1025851121 7:65244937-65244959 AAGACCCCCATCTCTACAAAAGG + Intergenic
1025877746 7:65501730-65501752 TAAACTCCTGTGTCTACAAATGG + Intergenic
1025882080 7:65547376-65547398 TAAACTCCTGTGTCTACAAATGG + Intergenic
1025891362 7:65655255-65655277 TAAACTCCTGTGTCTACAAATGG - Intergenic
1026430395 7:70341169-70341191 GAGACTCATGTCTCTGCCAAGGG - Intronic
1026681583 7:72471292-72471314 AATACACCTGTCTCAACCTAGGG - Intergenic
1029340010 7:99934891-99934913 GAGACTCCTGGCTCTAGCAGTGG - Intergenic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1049127442 8:140804782-140804804 AAAACACATGTCTCTACAAACGG - Intronic
1050332014 9:4555178-4555200 ATGACTCCTGTCTCTGTCACCGG - Intronic
1058342268 9:103912811-103912833 ATGACTCCTGTGCCCACCAATGG - Intergenic
1058845446 9:108953367-108953389 GGGACTCCTGCCTCTACCATGGG - Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1203613836 Un_KI270749v1:34608-34630 TAAACTCCTGTGTCTACAAATGG - Intergenic
1186273776 X:7918643-7918665 GAGCCTCCTGTCTCCACCTAAGG + Intronic
1192373943 X:70539913-70539935 AAGTCTGCTGTCTCTAGCCAAGG + Intronic
1201448517 Y:14084137-14084159 GATCCTCCTGTCTCTACCTAAGG - Intergenic
1201492222 Y:14554789-14554811 AGGACACCTGTTTCTACCACTGG - Intronic