ID: 1175874708

View in Genome Browser
Species Human (GRCh38)
Location 20:62223889-62223911
Sequence GGAGCAGGAGGGGCCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175874696_1175874708 12 Left 1175874696 20:62223854-62223876 CCAACAAGAAGACCACAGGCCTT No data
Right 1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG No data
1175874694_1175874708 28 Left 1175874694 20:62223838-62223860 CCATGGCGTCACGTCTCCAACAA No data
Right 1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG No data
1175874700_1175874708 0 Left 1175874700 20:62223866-62223888 CCACAGGCCTTCGGACCAGGGAA No data
Right 1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG No data
1175874702_1175874708 -7 Left 1175874702 20:62223873-62223895 CCTTCGGACCAGGGAAGGAGCAG No data
Right 1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175874708 Original CRISPR GGAGCAGGAGGGGCCCCGCC TGG Intergenic
No off target data available for this crispr