ID: 1175875404

View in Genome Browser
Species Human (GRCh38)
Location 20:62227249-62227271
Sequence CAGCTGCCCTGGAGCCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875404_1175875412 9 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875412 20:62227281-62227303 CCCAAACCCAAGTCCAGCTGTGG No data
1175875404_1175875414 10 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875414 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
1175875404_1175875415 11 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875415 20:62227283-62227305 CAAACCCAAGTCCAGCTGTGGGG No data
1175875404_1175875416 12 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875416 20:62227284-62227306 AAACCCAAGTCCAGCTGTGGGGG No data
1175875404_1175875420 30 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875404 Original CRISPR CAGCTGCCCTGGAGCCCTCT CGG (reversed) Intergenic