ID: 1175875408

View in Genome Browser
Species Human (GRCh38)
Location 20:62227275-62227297
Sequence CTGGACTTGGGTTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875408_1175875420 4 Left 1175875408 20:62227275-62227297 CCCAGCCCCAAACCCAAGTCCAG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875408 Original CRISPR CTGGACTTGGGTTTGGGGCT GGG (reversed) Intergenic