ID: 1175875409

View in Genome Browser
Species Human (GRCh38)
Location 20:62227276-62227298
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875409_1175875420 3 Left 1175875409 20:62227276-62227298 CCAGCCCCAAACCCAAGTCCAGC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875409 Original CRISPR GCTGGACTTGGGTTTGGGGC TGG (reversed) Intergenic