ID: 1175875410

View in Genome Browser
Species Human (GRCh38)
Location 20:62227280-62227302
Sequence CACAGCTGGACTTGGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875410_1175875430 29 Left 1175875410 20:62227280-62227302 CCCCAAACCCAAGTCCAGCTGTG No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data
1175875410_1175875420 -1 Left 1175875410 20:62227280-62227302 CCCCAAACCCAAGTCCAGCTGTG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875410 Original CRISPR CACAGCTGGACTTGGGTTTG GGG (reversed) Intergenic