ID: 1175875413

View in Genome Browser
Species Human (GRCh38)
Location 20:62227282-62227304
Sequence CCCACAGCTGGACTTGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875413_1175875434 30 Left 1175875413 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875413_1175875420 -3 Left 1175875413 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875413_1175875430 27 Left 1175875413 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875413 Original CRISPR CCCACAGCTGGACTTGGGTT TGG (reversed) Intergenic