ID: 1175875417

View in Genome Browser
Species Human (GRCh38)
Location 20:62227287-62227309
Sequence GGTCCCCCACAGCTGGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875417_1175875436 27 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875417_1175875435 26 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875435 20:62227336-62227358 CATCCGTAAGAGCATTTGGTGGG No data
1175875417_1175875430 22 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data
1175875417_1175875420 -8 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875417_1175875434 25 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875417 Original CRISPR GGTCCCCCACAGCTGGACTT GGG (reversed) Intergenic