ID: 1175875420

View in Genome Browser
Species Human (GRCh38)
Location 20:62227302-62227324
Sequence GGGGGACCCAGCCCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875410_1175875420 -1 Left 1175875410 20:62227280-62227302 CCCCAAACCCAAGTCCAGCTGTG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875409_1175875420 3 Left 1175875409 20:62227276-62227298 CCAGCCCCAAACCCAAGTCCAGC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875417_1175875420 -8 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875404_1175875420 30 Left 1175875404 20:62227249-62227271 CCGAGAGGGCTCCAGGGCAGCTG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875407_1175875420 19 Left 1175875407 20:62227260-62227282 CCAGGGCAGCTGGGACCCAGCCC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875408_1175875420 4 Left 1175875408 20:62227275-62227297 CCCAGCCCCAAACCCAAGTCCAG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875411_1175875420 -2 Left 1175875411 20:62227281-62227303 CCCAAACCCAAGTCCAGCTGTGG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875418_1175875420 -9 Left 1175875418 20:62227288-62227310 CCAAGTCCAGCTGTGGGGGACCC No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data
1175875413_1175875420 -3 Left 1175875413 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
Right 1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875420 Original CRISPR GGGGGACCCAGCCCCAGCCC AGG Intergenic