ID: 1175875421

View in Genome Browser
Species Human (GRCh38)
Location 20:62227308-62227330
Sequence AGGGCTCCTGGGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875421_1175875434 4 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875421_1175875436 6 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875421_1175875435 5 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875435 20:62227336-62227358 CATCCGTAAGAGCATTTGGTGGG No data
1175875421_1175875438 16 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875421_1175875430 1 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875421 Original CRISPR AGGGCTCCTGGGCTGGGGCT GGG (reversed) Intergenic