ID: 1175875425

View in Genome Browser
Species Human (GRCh38)
Location 20:62227315-62227337
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875425_1175875435 -2 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875435 20:62227336-62227358 CATCCGTAAGAGCATTTGGTGGG No data
1175875425_1175875430 -6 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data
1175875425_1175875436 -1 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875425_1175875434 -3 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875425_1175875438 9 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875425 Original CRISPR TGGGGCGAGGGCTCCTGGGC TGG (reversed) Intergenic