ID: 1175875426

View in Genome Browser
Species Human (GRCh38)
Location 20:62227319-62227341
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875426_1175875430 -10 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875430 20:62227332-62227354 GCCCCATCCGTAAGAGCATTTGG No data
1175875426_1175875438 5 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875426_1175875436 -5 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875426_1175875435 -6 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875435 20:62227336-62227358 CATCCGTAAGAGCATTTGGTGGG No data
1175875426_1175875434 -7 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875426 Original CRISPR CGGATGGGGCGAGGGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr