ID: 1175875427

View in Genome Browser
Species Human (GRCh38)
Location 20:62227320-62227342
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875427_1175875436 -6 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875427_1175875434 -8 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875427_1175875435 -7 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875435 20:62227336-62227358 CATCCGTAAGAGCATTTGGTGGG No data
1175875427_1175875438 4 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875427 Original CRISPR ACGGATGGGGCGAGGGCTCC TGG (reversed) Intergenic