ID: 1175875428

View in Genome Browser
Species Human (GRCh38)
Location 20:62227327-62227349
Sequence TGCTCTTACGGATGGGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875428_1175875444 28 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875428_1175875443 27 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875443 20:62227377-62227399 CCAACAGAGCAGCACTGCCTGGG No data
1175875428_1175875441 26 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875441 20:62227376-62227398 TCCAACAGAGCAGCACTGCCTGG 0: 2
1: 0
2: 1
3: 12
4: 191
1175875428_1175875445 29 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875445 20:62227379-62227401 AACAGAGCAGCACTGCCTGGGGG No data
1175875428_1175875446 30 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875446 20:62227380-62227402 ACAGAGCAGCACTGCCTGGGGGG No data
1175875428_1175875438 -3 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875428 Original CRISPR TGCTCTTACGGATGGGGCGA GGG (reversed) Intergenic
No off target data available for this crispr