ID: 1175875432

View in Genome Browser
Species Human (GRCh38)
Location 20:62227334-62227356
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875432_1175875438 -10 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875432_1175875441 19 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875441 20:62227376-62227398 TCCAACAGAGCAGCACTGCCTGG No data
1175875432_1175875444 21 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875432_1175875446 23 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875446 20:62227380-62227402 ACAGAGCAGCACTGCCTGGGGGG No data
1175875432_1175875443 20 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875443 20:62227377-62227399 CCAACAGAGCAGCACTGCCTGGG No data
1175875432_1175875445 22 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875445 20:62227379-62227401 AACAGAGCAGCACTGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875432 Original CRISPR CACCAAATGCTCTTACGGAT GGG (reversed) Intergenic