ID: 1175875434

View in Genome Browser
Species Human (GRCh38)
Location 20:62227335-62227357
Sequence CCATCCGTAAGAGCATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875425_1175875434 -3 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875418_1175875434 24 Left 1175875418 20:62227288-62227310 CCAAGTCCAGCTGTGGGGGACCC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875424_1175875434 -2 Left 1175875424 20:62227314-62227336 CCCAGCCCAGGAGCCCTCGCCCC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875421_1175875434 4 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875419_1175875434 18 Left 1175875419 20:62227294-62227316 CCAGCTGTGGGGGACCCAGCCCC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875427_1175875434 -8 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875426_1175875434 -7 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875417_1175875434 25 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875413_1175875434 30 Left 1175875413 20:62227282-62227304 CCAAACCCAAGTCCAGCTGTGGG No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875422_1175875434 3 Left 1175875422 20:62227309-62227331 CCAGCCCCAGCCCAGGAGCCCTC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
1175875423_1175875434 -1 Left 1175875423 20:62227313-62227335 CCCCAGCCCAGGAGCCCTCGCCC No data
Right 1175875434 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875434 Original CRISPR CCATCCGTAAGAGCATTTGG TGG Intergenic