ID: 1175875436

View in Genome Browser
Species Human (GRCh38)
Location 20:62227337-62227359
Sequence ATCCGTAAGAGCATTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875426_1175875436 -5 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875423_1175875436 1 Left 1175875423 20:62227313-62227335 CCCCAGCCCAGGAGCCCTCGCCC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875418_1175875436 26 Left 1175875418 20:62227288-62227310 CCAAGTCCAGCTGTGGGGGACCC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875425_1175875436 -1 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875419_1175875436 20 Left 1175875419 20:62227294-62227316 CCAGCTGTGGGGGACCCAGCCCC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875427_1175875436 -6 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875421_1175875436 6 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875417_1175875436 27 Left 1175875417 20:62227287-62227309 CCCAAGTCCAGCTGTGGGGGACC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875422_1175875436 5 Left 1175875422 20:62227309-62227331 CCAGCCCCAGCCCAGGAGCCCTC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data
1175875424_1175875436 0 Left 1175875424 20:62227314-62227336 CCCAGCCCAGGAGCCCTCGCCCC No data
Right 1175875436 20:62227337-62227359 ATCCGTAAGAGCATTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875436 Original CRISPR ATCCGTAAGAGCATTTGGTG GGG Intergenic