ID: 1175875437

View in Genome Browser
Species Human (GRCh38)
Location 20:62227339-62227361
Sequence GGCCCCACCAAATGCTCTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875437_1175875446 18 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875446 20:62227380-62227402 ACAGAGCAGCACTGCCTGGGGGG No data
1175875437_1175875445 17 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875445 20:62227379-62227401 AACAGAGCAGCACTGCCTGGGGG No data
1175875437_1175875443 15 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875443 20:62227377-62227399 CCAACAGAGCAGCACTGCCTGGG No data
1175875437_1175875441 14 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875441 20:62227376-62227398 TCCAACAGAGCAGCACTGCCTGG No data
1175875437_1175875444 16 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875437 Original CRISPR GGCCCCACCAAATGCTCTTA CGG (reversed) Intergenic