ID: 1175875438

View in Genome Browser
Species Human (GRCh38)
Location 20:62227347-62227369
Sequence GCATTTGGTGGGGCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875419_1175875438 30 Left 1175875419 20:62227294-62227316 CCAGCTGTGGGGGACCCAGCCCC No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875427_1175875438 4 Left 1175875427 20:62227320-62227342 CCAGGAGCCCTCGCCCCATCCGT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875424_1175875438 10 Left 1175875424 20:62227314-62227336 CCCAGCCCAGGAGCCCTCGCCCC No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875423_1175875438 11 Left 1175875423 20:62227313-62227335 CCCCAGCCCAGGAGCCCTCGCCC No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875429_1175875438 -4 Left 1175875429 20:62227328-62227350 CCTCGCCCCATCCGTAAGAGCAT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875422_1175875438 15 Left 1175875422 20:62227309-62227331 CCAGCCCCAGCCCAGGAGCCCTC No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875426_1175875438 5 Left 1175875426 20:62227319-62227341 CCCAGGAGCCCTCGCCCCATCCG No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875432_1175875438 -10 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875428_1175875438 -3 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875425_1175875438 9 Left 1175875425 20:62227315-62227337 CCAGCCCAGGAGCCCTCGCCCCA No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875421_1175875438 16 Left 1175875421 20:62227308-62227330 CCCAGCCCCAGCCCAGGAGCCCT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data
1175875431_1175875438 -9 Left 1175875431 20:62227333-62227355 CCCCATCCGTAAGAGCATTTGGT No data
Right 1175875438 20:62227347-62227369 GCATTTGGTGGGGCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875438 Original CRISPR GCATTTGGTGGGGCCTCCTG TGG Intergenic
No off target data available for this crispr