ID: 1175875439

View in Genome Browser
Species Human (GRCh38)
Location 20:62227360-62227382
Sequence TGTTGGATCATAGCCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875439_1175875446 -3 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875446 20:62227380-62227402 ACAGAGCAGCACTGCCTGGGGGG No data
1175875439_1175875444 -5 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875439_1175875443 -6 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875443 20:62227377-62227399 CCAACAGAGCAGCACTGCCTGGG No data
1175875439_1175875445 -4 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875445 20:62227379-62227401 AACAGAGCAGCACTGCCTGGGGG No data
1175875439_1175875441 -7 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875441 20:62227376-62227398 TCCAACAGAGCAGCACTGCCTGG No data
1175875439_1175875448 16 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875448 20:62227399-62227421 GGGGCCTCCGAGCCAAACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875439 Original CRISPR TGTTGGATCATAGCCACAGG AGG (reversed) Intergenic