ID: 1175875444

View in Genome Browser
Species Human (GRCh38)
Location 20:62227378-62227400
Sequence CAACAGAGCAGCACTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175875440_1175875444 -8 Left 1175875440 20:62227363-62227385 CCTGTGGCTATGATCCAACAGAG No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875437_1175875444 16 Left 1175875437 20:62227339-62227361 CCGTAAGAGCATTTGGTGGGGCC No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875439_1175875444 -5 Left 1175875439 20:62227360-62227382 CCTCCTGTGGCTATGATCCAACA No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875431_1175875444 22 Left 1175875431 20:62227333-62227355 CCCCATCCGTAAGAGCATTTGGT No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875428_1175875444 28 Left 1175875428 20:62227327-62227349 CCCTCGCCCCATCCGTAAGAGCA No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875433_1175875444 20 Left 1175875433 20:62227335-62227357 CCATCCGTAAGAGCATTTGGTGG No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875432_1175875444 21 Left 1175875432 20:62227334-62227356 CCCATCCGTAAGAGCATTTGGTG No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data
1175875429_1175875444 27 Left 1175875429 20:62227328-62227350 CCTCGCCCCATCCGTAAGAGCAT No data
Right 1175875444 20:62227378-62227400 CAACAGAGCAGCACTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175875444 Original CRISPR CAACAGAGCAGCACTGCCTG GGG Intergenic