ID: 1175877117

View in Genome Browser
Species Human (GRCh38)
Location 20:62235605-62235627
Sequence GGTGACCTCCCCCATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175877104_1175877117 25 Left 1175877104 20:62235557-62235579 CCCGCATGCCAGCCCTGGGAGGT 0: 1
1: 1
2: 0
3: 29
4: 312
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1175877110_1175877117 12 Left 1175877110 20:62235570-62235592 CCTGGGAGGTATGTGGGTCATGA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1175877108_1175877117 17 Left 1175877108 20:62235565-62235587 CCAGCCCTGGGAGGTATGTGGGT 0: 1
1: 0
2: 0
3: 22
4: 192
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1175877105_1175877117 24 Left 1175877105 20:62235558-62235580 CCGCATGCCAGCCCTGGGAGGTA 0: 1
1: 1
2: 10
3: 79
4: 461
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1175877109_1175877117 13 Left 1175877109 20:62235569-62235591 CCCTGGGAGGTATGTGGGTCATG 0: 1
1: 1
2: 6
3: 35
4: 349
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1175877102_1175877117 26 Left 1175877102 20:62235556-62235578 CCCCGCATGCCAGCCCTGGGAGG 0: 1
1: 0
2: 2
3: 21
4: 273
Right 1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175877117 Original CRISPR GGTGACCTCCCCCATGGTGA GGG Intronic
900322838 1:2093598-2093620 GGTGCCCTCCTCAAAGGTGAGGG + Intronic
900473206 1:2864468-2864490 GGTGGCTCCCCCCAGGGTGAGGG - Intergenic
903534472 1:24057484-24057506 GTTGACCTTCTCAATGGTGATGG + Exonic
904355978 1:29940131-29940153 GATGACCAACCCCATGGTGATGG + Intergenic
905208291 1:36355589-36355611 GCTGACCTGCCCCATGGTCTAGG - Intronic
906263971 1:44414604-44414626 GGTGGCATCCCCCATGGAGATGG + Intronic
906321265 1:44818413-44818435 GGTGAGCTCCCTTATGGAGAGGG + Intergenic
907933033 1:59017762-59017784 GGTGACCACCCTCAGAGTGAAGG - Intergenic
908207653 1:61867936-61867958 GGTGCCCTCCCAAATGGTGAAGG + Intronic
915491730 1:156253767-156253789 GGTGATGTCCTGCATGGTGACGG - Intronic
919862719 1:201752244-201752266 ACTGATCCCCCCCATGGTGAGGG + Intronic
922668738 1:227493427-227493449 GGTGAACTCAGCCATGGTCAGGG + Intergenic
922670858 1:227507872-227507894 GGTGAACTCAGCCATGGTCAGGG - Intergenic
1067069140 10:43119672-43119694 GATGAGGTCGCCCATGGTGAGGG - Exonic
1067286807 10:44912917-44912939 GGTGACCTTGCCCAAGGTCATGG + Intronic
1067296264 10:44976753-44976775 GGAGAGTTCCCCCATGATGAGGG - Exonic
1075469864 10:122680034-122680056 ATAGACCTCACCCATGGTGAAGG - Intergenic
1075568182 10:123519906-123519928 GGTGTCCACCCCCAATGTGAAGG - Intergenic
1075583887 10:123643475-123643497 CGGGTCCTCCCCCAAGGTGAGGG + Intergenic
1076881128 10:133239724-133239746 GCGGACCTGCTCCATGGTGAAGG - Exonic
1079422214 11:20304150-20304172 GGTGACCTCCTCCATGTACATGG - Intergenic
1083406425 11:62460430-62460452 GGGGAGCTCCCCCAGGCTGAAGG - Intronic
1084268814 11:68018558-68018580 GGTGACCTCGCCCTGGCTGATGG - Exonic
1084308317 11:68300674-68300696 GGGGACCTCGCCCTTGGTGGGGG + Intergenic
1084710316 11:70840073-70840095 GCTGACTCCCCACATGGTGACGG + Intronic
1085255608 11:75170954-75170976 TGTGAAATCCCCCATGGAGAAGG - Intronic
1089268163 11:117281949-117281971 TGTGACCTGCCCAATGGAGAAGG - Exonic
1097176905 12:57148611-57148633 GGTGGCATCCTCCAAGGTGAAGG - Intronic
1097533932 12:60840964-60840986 GGTGCCCTCCCCAGTGGTAATGG - Intergenic
1101050348 12:100856674-100856696 GTATACCTCACCCATGGTGAGGG + Intronic
1103414829 12:120737071-120737093 GCTGATCTCCTCCATGGCGATGG - Exonic
1103903329 12:124314801-124314823 GGTGGCCACCCCCAGGGTCAGGG + Exonic
1113905330 13:113816851-113816873 GGTCACCTGCCCCAGGGTCAAGG - Exonic
1114263674 14:21058203-21058225 GGTGAGCTCACCCATGGTCAGGG - Exonic
1117479694 14:56130133-56130155 GGGGACCTCCCCCAAGGAGCAGG - Intronic
1120043154 14:79776495-79776517 GGTTCCCTCCCCCATGGGCATGG + Intronic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1121865528 14:97359197-97359219 GATGACCTCCCCTACTGTGATGG - Intergenic
1122952694 14:105054357-105054379 GGTGACTTGCCCCATCGTGCTGG - Intronic
1126698041 15:51342026-51342048 GATGACCTACTCCATGGTGCCGG + Exonic
1130726560 15:86445183-86445205 GCTGCTCTCCCCCAGGGTGATGG - Intronic
1132749073 16:1449041-1449063 GGTGGCCTCCATCATGATGACGG + Exonic
1132869921 16:2111414-2111436 GGTGCCGTCCCCCATGTCGAAGG + Exonic
1134717501 16:16364187-16364209 GGTGCCGTCCCCCATGTCGAAGG - Intergenic
1134957251 16:18387972-18387994 GGTGCCGTCCCCCATGTCGAAGG + Intergenic
1139063287 16:63281871-63281893 GATGCCCTCCCACATGGGGAAGG + Intergenic
1141987130 16:87587467-87587489 GTTGAACACCCCCATGTTGATGG + Intergenic
1142230221 16:88896655-88896677 AGTGAGGTCTCCCATGGTGACGG - Intronic
1143164698 17:4892049-4892071 GGTGAGCTCCCCCACTTTGATGG - Intronic
1144759876 17:17701159-17701181 GGTGGGCTAGCCCATGGTGAAGG + Intronic
1145064842 17:19755420-19755442 GGTGACCTCACACATGTAGAGGG - Intergenic
1147214290 17:38890437-38890459 GGTGTCCGCCACCATGGTGAAGG - Exonic
1150131988 17:62674404-62674426 AGTGGCTTCCCCCATGGGGAGGG - Intronic
1150654444 17:67030823-67030845 GGACAGCTCCCCCATGGGGATGG - Exonic
1150655406 17:67035953-67035975 GGTGACCTCCCCCACTGGGATGG - Intergenic
1150809623 17:68346462-68346484 GGACGCCACCCCCATGGTGAGGG - Intronic
1151474925 17:74339888-74339910 AGTGACCTTCTCCACGGTGAGGG + Intronic
1154204476 18:12325478-12325500 GGTGACCCCACTCATGGTGGCGG - Exonic
1160507823 18:79437139-79437161 CGGGACCTCGGCCATGGTGATGG + Intronic
1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG + Intronic
1163061796 19:14766668-14766690 GGGAACCTCCACCATAGTGAGGG - Intronic
1163298810 19:16430140-16430162 GGTCACATCCTCCAGGGTGAGGG - Intronic
1166310163 19:41958361-41958383 GGTGACGTCCCCTATGTTGCTGG - Exonic
1168598856 19:57701895-57701917 TGTGAACTCCCCGATGTTGAAGG + Exonic
1168598888 19:57702147-57702169 TGTGAACTCCCCGATGTTGAAGG + Exonic
926391283 2:12396138-12396160 GGTGACCTCCTCCATGGCACAGG - Intergenic
928202574 2:29258205-29258227 GTTGAACTGCCCCATGGAGAAGG - Intronic
935648661 2:105363448-105363470 AGTGACCCCTCCCGTGGTGATGG + Exonic
936437778 2:112522864-112522886 GGTGTCTTCCACCATAGTGAAGG + Intronic
936487522 2:112939039-112939061 GGTGACCTCCCCTTTGGTTGAGG + Intergenic
936526401 2:113244548-113244570 GGTGGCCACCCCCAAGGTGGTGG - Exonic
938133663 2:128736925-128736947 GCTCACGTCCCCCATGATGAAGG - Intergenic
938642774 2:133299329-133299351 GGTGAGGAGCCCCATGGTGATGG + Intronic
948003412 2:234587567-234587589 GGTTTCCTGCCCCATGCTGATGG + Intergenic
948165923 2:235862546-235862568 ACTGCCCTACCCCATGGTGATGG - Intronic
1171271807 20:23823922-23823944 GGAGACCTCCCACAGGGTGGGGG + Exonic
1171278164 20:23876089-23876111 GGAGACCTCCCCCAGGGTGGGGG + Exonic
1171283245 20:23918672-23918694 GGAGACCTCCCCCAGGGTTGGGG + Intergenic
1171299147 20:24044121-24044143 GATGACGTCTCCTATGGTGAAGG + Intergenic
1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG + Intronic
1183353828 22:37348241-37348263 GGTGTCCTCCCCCAAGAAGATGG - Intergenic
950108097 3:10401057-10401079 GGTGACCTCCTCCCTGCCGACGG - Exonic
955498377 3:59560367-59560389 TGTGAACTCCCCTATGGAGAGGG - Intergenic
957801013 3:85081641-85081663 GGTTACGTCCCACAGGGTGAAGG + Intronic
960937191 3:122911501-122911523 GGTGGCCTCCTCCATGCTGGAGG + Exonic
961371201 3:126433119-126433141 TGTGTCCTCCTCCTTGGTGATGG - Exonic
966396361 3:179507702-179507724 GGTGAAGTCCCCCTTGATGAGGG + Intergenic
975551705 4:75619541-75619563 ACAGACCTCCCACATGGTGATGG + Intronic
981000952 4:139828832-139828854 GGTGGCCTCTCCCATTGTCATGG + Intronic
983004130 4:162461666-162461688 GCTGACCTCACCCAGAGTGAGGG - Intergenic
997472464 5:134124500-134124522 GGTGACCTCCTCCCAGGAGAAGG - Intronic
997956092 5:138279704-138279726 GGTGACCTCTGCCATAGAGAAGG - Intergenic
998365670 5:141629256-141629278 ATTGACATCCACCATGGTGACGG - Exonic
1001138783 5:169125567-169125589 AGGGACCTCCCTCACGGTGAAGG - Intronic
1002044047 5:176532266-176532288 GGTGACTCCCCCCATGGGGAGGG + Intronic
1006084974 6:31589098-31589120 GCTGAGCTCCCACATGGTGGTGG + Exonic
1009559844 6:65225369-65225391 GGATACATCCCCCTTGGTGAGGG - Intronic
1010251737 6:73714300-73714322 GGTGGCCTCCCTCCTGGGGATGG + Intronic
1018672823 6:166193786-166193808 GGTGACACCCGCCATGGAGACGG + Intergenic
1018990122 6:168668292-168668314 GATGACCTTCCACATGGTCAGGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019103213 6:169648819-169648841 GGTGCCCTCCCCAATGGCGTGGG + Intronic
1021993841 7:26161110-26161132 TATGACCTCCCCCTTGGGGAGGG - Intronic
1024002338 7:45199050-45199072 GGAGAGCTCCACCATGGGGATGG - Intergenic
1026231743 7:68489915-68489937 GGTGACCAGCTCCCTGGTGATGG + Intergenic
1029273057 7:99388360-99388382 GATGGACTCCCCCAGGGTGATGG - Intronic
1029663516 7:101979292-101979314 GATGACCTGCTCCAGGGTGAGGG - Intronic
1032431271 7:131864013-131864035 TGTCACCTCTCCCATGATGAAGG + Intergenic
1035732903 8:1865385-1865407 GGTGACCACCCCCTGGGTGCTGG - Intronic
1037316749 8:17606516-17606538 GGTGACCTAACCAATGCTGAAGG + Intronic
1037772410 8:21810321-21810343 GCTGACCTCCCCCAAGCTGGAGG - Intronic
1039204909 8:35141400-35141422 GGAGACCTACCCCAGGGTGACGG - Intergenic
1039461000 8:37744284-37744306 GGTGCAGTCCCCCAGGGTGATGG - Intronic
1044748124 8:95390863-95390885 GGTTTCCTCTCCCAGGGTGATGG - Intergenic
1046641178 8:116733413-116733435 GGTGACCTGCTCCATCCTGAGGG + Intronic
1047892815 8:129331297-129331319 GATGTCCACCCACATGGTGAGGG + Intergenic
1052047436 9:23810865-23810887 GGTGAACTACCACAAGGTGATGG - Intronic
1052273421 9:26651734-26651756 GGTGGTTTCCCCCATGCTGAGGG - Intergenic
1053105257 9:35403356-35403378 GGTGACCTTCCCCTTGGAGGAGG - Intronic
1053297048 9:36922571-36922593 GGTGACCTGCCACAGGGAGAGGG + Intronic
1054788860 9:69236118-69236140 GAAGACCTCCCCTCTGGTGAAGG - Exonic
1056600985 9:88046794-88046816 GCTCACCTCCCCCATGGAGGAGG - Intergenic
1059221169 9:112620457-112620479 GCTGAGCTCTCCCATGGTCAGGG + Intronic
1059246950 9:112856811-112856833 GGTCTTCTGCCCCATGGTGAGGG - Intronic
1061382347 9:130265970-130265992 GGTGGCGTCCCCCGTGGTGGGGG - Intergenic
1062101366 9:134730368-134730390 GATGACCTCACCTATGGCGAGGG + Exonic
1062140675 9:134956224-134956246 GGTGAGCCCCACCGTGGTGAAGG - Intergenic
1062536379 9:137022865-137022887 AGTGACATCCGCCATGGTGCAGG - Exonic
1186066830 X:5775409-5775431 AATGGCCGCCCCCATGGTGATGG - Intergenic
1187124794 X:16445122-16445144 GGTTACCTCACCCTGGGTGATGG + Intergenic
1187281602 X:17861444-17861466 GGTGATCTCGCCCACGGGGAGGG + Intergenic
1188141552 X:26557909-26557931 GTCGACCTGCCCCATGGTGAAGG - Intergenic
1192403737 X:70863078-70863100 GGTGCTCTCTCCCAGGGTGATGG - Intronic
1194139897 X:90196481-90196503 GGTGCTCTCTCCCATGGAGATGG - Intergenic
1195249780 X:103031845-103031867 TGTGACCTCCCCTATGGTCCAGG + Intergenic