ID: 1175877146

View in Genome Browser
Species Human (GRCh38)
Location 20:62235748-62235770
Sequence CTGAGAAATGCTCATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175877146_1175877150 20 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877150 20:62235791-62235813 GACACAGCCGCCAGCCCACCTGG 0: 1
1: 1
2: 1
3: 21
4: 275
1175877146_1175877148 -3 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877148 20:62235768-62235790 CAGGCTCTAGAGAGCATGTGTGG 0: 1
1: 0
2: 2
3: 19
4: 285
1175877146_1175877149 -2 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877149 20:62235769-62235791 AGGCTCTAGAGAGCATGTGTGGG 0: 1
1: 0
2: 3
3: 13
4: 286
1175877146_1175877154 27 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877154 20:62235798-62235820 CCGCCAGCCCACCTGGTGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1175877146_1175877152 26 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877152 20:62235797-62235819 GCCGCCAGCCCACCTGGTGCGGG 0: 1
1: 0
2: 2
3: 31
4: 206
1175877146_1175877151 25 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877151 20:62235796-62235818 AGCCGCCAGCCCACCTGGTGCGG 0: 1
1: 0
2: 2
3: 22
4: 177
1175877146_1175877155 28 Left 1175877146 20:62235748-62235770 CCTGCAGGATGAGCATTTCTCAG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1175877155 20:62235799-62235821 CGCCAGCCCACCTGGTGCGGGGG 0: 1
1: 0
2: 1
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175877146 Original CRISPR CTGAGAAATGCTCATCCTGC AGG (reversed) Intronic
901853721 1:12031303-12031325 CTGAGAAAAGCTCAGCCCCCAGG + Exonic
902769292 1:18636479-18636501 CGGAGAAACTCTCATGCTGCGGG + Intronic
906273385 1:44498785-44498807 CTCAGAAATGCGCATCCTTGGGG - Intronic
906312940 1:44766918-44766940 CTGAGAAATGCTTGGCTTGCTGG - Exonic
910508602 1:87978272-87978294 CAGAAAAATGCTCATCATGTTGG + Intergenic
911449262 1:98044557-98044579 CTGAGAAAGGCCCATCCTCCAGG + Intergenic
912192767 1:107359504-107359526 CAGAGAAATGATCATCCTATAGG - Intronic
913371609 1:118105813-118105835 CTGAGTAATGCTCTTCTTACTGG - Intronic
914420838 1:147527108-147527130 CTGGGACATCCTCATCCTGTAGG + Intergenic
916711769 1:167416915-167416937 CTGAAAAATGCTCCTGCTGTTGG + Exonic
916980699 1:170133723-170133745 CTGTATAATGATCATCCTGCTGG + Intergenic
920225157 1:204433256-204433278 CTGAGTAATTCCCAGCCTGCCGG - Intronic
920927711 1:210358300-210358322 CTGAGAAATTCTGAGTCTGCAGG - Intronic
922884169 1:229005265-229005287 CTCACACATGCACATCCTGCAGG - Intergenic
922984257 1:229853773-229853795 CAGAGCAATGGGCATCCTGCTGG - Intergenic
924743205 1:246809682-246809704 CTGTGAAAGGCTCCCCCTGCGGG - Intergenic
1064759230 10:18601654-18601676 ATGAGAACTGCTAATCCAGCTGG - Intronic
1065226463 10:23548616-23548638 CTGAAACATGCTCAGTCTGCAGG + Intergenic
1067914283 10:50379956-50379978 CTGAATAATGCTCAGTCTGCTGG - Intronic
1067935027 10:50603207-50603229 CTGTAAAAAGCTCATCCTACAGG - Intronic
1069816911 10:71202569-71202591 CTGTGAAGTGGCCATCCTGCAGG - Intergenic
1072550038 10:96470219-96470241 CTGAGAATTTCTCTTGCTGCTGG + Intronic
1072797530 10:98367338-98367360 ATGAGAAAGACTCAACCTGCGGG - Intergenic
1077988808 11:7382916-7382938 CTCAGAAATTGTCATCCTCCAGG + Intronic
1078604218 11:12760847-12760869 CTGAGAAATGCTCCCCATACTGG - Intronic
1079414223 11:20218066-20218088 ATGAGAAATGCTGAGCATGCTGG - Intergenic
1079606979 11:22382070-22382092 CTCAGAAAGCCTCATGCTGCAGG + Intergenic
1084125363 11:67095631-67095653 CGGAGAAGTGCTCACACTGCAGG + Intergenic
1084748361 11:71187940-71187962 CTTGGAAATGCTCTTCCTACTGG + Intronic
1085690930 11:78663148-78663170 CTGAGGAAGGCTGAGCCTGCTGG - Intronic
1085707473 11:78799776-78799798 CTGTAAAATGCTCATGCTGCGGG - Intronic
1086665897 11:89481833-89481855 CTGGGCAATGCTCAGCCTGGAGG - Intronic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1090414476 11:126531169-126531191 CTGAGAGATGTACAGCCTGCTGG - Intronic
1090720594 11:129468822-129468844 CTGAGAAATCCGCTTCCTGATGG - Intergenic
1090893677 11:130950327-130950349 ATGAGAACTGATCATCCTGATGG + Intergenic
1096604488 12:52754880-52754902 CTGAGCAATGCTCACCATTCTGG + Intergenic
1096678857 12:53241800-53241822 CTGAGCCTTGCTGATCCTGCAGG - Intergenic
1099312317 12:81042281-81042303 CTGGGATATGCTCATGCAGCAGG - Intronic
1101245075 12:102877427-102877449 CTGAAAAAATCTCATCCTACGGG + Intronic
1101706573 12:107226009-107226031 CTGAGGTTTGCTCATACTGCTGG + Intergenic
1102992524 12:117325226-117325248 CTGGAAAATGCTCATCCTCCCGG - Intronic
1103347606 12:120261814-120261836 TGGAGAAATGCTCAGCCTACTGG - Intronic
1106134426 13:26963279-26963301 CAGCGAGATGCTCATCCTGATGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106885376 13:34179096-34179118 ATGAGTAATGCTCTTCCTGCTGG + Intergenic
1107565865 13:41603694-41603716 CTGAGAAAAGCACACCCTGGTGG - Intronic
1108745150 13:53385932-53385954 CTGTGAAATGGACATCCTGAAGG + Intergenic
1109152244 13:58859738-58859760 CTGAGAAATGCAAATTCGGCAGG - Intergenic
1111909744 13:94297541-94297563 CTGAGAAATGCAAATCCTTCAGG + Intronic
1112796619 13:103064049-103064071 CTCATAAATGCTCCTCATGCGGG - Intronic
1114622663 14:24106050-24106072 CTGGGTAATGCTGATGCTGCCGG + Intronic
1115921892 14:38383684-38383706 CTGAGAAGAGCTCAACCTTCTGG + Intergenic
1118021918 14:61725716-61725738 CTGAGAAAAGAGCATCTTGCTGG - Intronic
1119424885 14:74528726-74528748 CTGAGAGGTGCTGTTCCTGCAGG + Intronic
1120192369 14:81450896-81450918 CTGAGAAATTCTCATTCAGCAGG - Intergenic
1121019847 14:90573234-90573256 TTGGGGAATGCTCATCCTGCAGG + Intronic
1126200379 15:45978909-45978931 CAGAAAAATGCTTATTCTGCTGG + Intergenic
1126415512 15:48413965-48413987 GTGATAAATGCTCATCCTGTGGG + Intronic
1127262788 15:57338140-57338162 CTGTGAAAAGCACTTCCTGCAGG + Intergenic
1127725419 15:61744772-61744794 CTGGGAAATGCTCCTGTTGCTGG - Intergenic
1129302537 15:74633828-74633850 CTGAGAAATGCTAATACTCTAGG - Intronic
1130380479 15:83367925-83367947 CCCAGAAATGCTGATGCTGCTGG + Intergenic
1132330905 15:101012079-101012101 CTGAGAAATCCACATCCTTCAGG - Exonic
1133278075 16:4649928-4649950 CTGAGAAAGGCTCCACCTGAGGG - Intronic
1133716002 16:8449501-8449523 AGGAGAAATGCTCATGATGCAGG + Intergenic
1133911514 16:10070316-10070338 CTGGGAGATGCTGATGCTGCTGG - Intronic
1134327298 16:13218781-13218803 ATGAGAAATGCTCATGCAGGAGG + Intronic
1135153496 16:20031601-20031623 CTGAGAATTGCCCAGTCTGCGGG + Exonic
1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG + Intergenic
1138005410 16:53331263-53331285 ATGAAAAATGCTCATCATCCTGG - Intergenic
1138006848 16:53345168-53345190 ATGAAAAATGCTCATCATCCTGG - Intergenic
1140859123 16:79003994-79004016 CTGAGTACTTCTCATCCTTCAGG + Intronic
1142930663 17:3281528-3281550 TTGAAAAATGCTGATGCTGCCGG - Intergenic
1144397643 17:14860708-14860730 GTGAGAAATGCTTAGCTTGCGGG - Intergenic
1145085725 17:19937935-19937957 CTCAGAAATTCTGATTCTGCAGG - Intronic
1145107840 17:20134781-20134803 ATGAGAAATGCTGTCCCTGCAGG + Intronic
1146951935 17:36912870-36912892 CTGAGAAGTGCTAATCTCGCAGG + Intergenic
1147728447 17:42581617-42581639 CTCAGAAATGGGCATCCAGCTGG + Exonic
1153532960 18:6068588-6068610 TTGAGAAGTGCTCCTCCTGTGGG + Intronic
1154378578 18:13829331-13829353 CTGAGACATGGCCATCCTACAGG - Intergenic
1156174021 18:34521138-34521160 CTGATACATGCTCCTCCTCCAGG + Intronic
1156420397 18:36946432-36946454 CTGAGTAATGCTGATGTTGCTGG - Intronic
1158418299 18:57269530-57269552 TGGAGAAATACTCATCCAGCAGG + Intergenic
1159203017 18:65212464-65212486 CTAAGAAATGCTCAGACAGCTGG - Intergenic
1164014542 19:21241827-21241849 CTGAGAAATGTTCTTGCTGTGGG - Intronic
1164629191 19:29750574-29750596 CTGAGAAATCCTCACCTTCCAGG - Intergenic
1167555488 19:50192578-50192600 CTGAGAAATTCTCCTCTAGCTGG - Intronic
1168543416 19:57231276-57231298 CTGGGCAAAGCTCAACCTGCAGG + Exonic
925804393 2:7633833-7633855 CTGACAAATACACATCCTGGGGG + Intergenic
927504298 2:23603202-23603224 GTGAGAAATGCCCACCCTGTAGG + Intronic
928611015 2:32992819-32992841 GTGAGAGATGCTCCTCCAGCGGG + Intronic
929564238 2:42974933-42974955 CAGAGGAATGCTCAGCCTACTGG + Intergenic
931291898 2:60881231-60881253 CTGAGAAATCCCCCTCCTCCAGG - Intergenic
934129571 2:88935109-88935131 ATGAGAAATGCTGATTCTTCTGG - Intergenic
935149719 2:100422844-100422866 CTGAGAAATGTTCAGCCAGAGGG + Intergenic
936397514 2:112140595-112140617 CTGAGAAATCTTCTTCCTCCCGG - Intronic
940733534 2:157422043-157422065 CTGAGAAAAGCTGATGCTGCTGG + Intronic
943485551 2:188474569-188474591 CTCAGAAATGCTCCTGCTGAGGG + Intronic
946682983 2:222237095-222237117 GAGAGAAATCCTCATCCTCCTGG - Intronic
947872344 2:233446378-233446400 CTGTGAAATGCTCATCTCACTGG + Intronic
948013237 2:234666884-234666906 GTGAGACCTGCTCAGCCTGCAGG - Intergenic
1169934770 20:10871552-10871574 CTGAGAGATGCTGATGCTGCTGG + Intergenic
1170586878 20:17741447-17741469 CTGAGGAATGAACTTCCTGCAGG - Intergenic
1173026209 20:39309811-39309833 CTGAGTGATGCTAATGCTGCTGG + Intergenic
1174668391 20:52282542-52282564 TTGATAAATGCTCTTCCTGCTGG + Intergenic
1175271511 20:57737329-57737351 CTAAGTCATTCTCATCCTGCAGG + Intergenic
1175526722 20:59639339-59639361 GTGGGAAATGCTCATCCTGCAGG - Intronic
1175648630 20:60697320-60697342 CTGACCACTGCACATCCTGCTGG - Intergenic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1179233060 21:39522885-39522907 CTGAGGAGTGCTCCTCCTGTGGG + Intergenic
1180220538 21:46355532-46355554 CTGAGACATGCCCCTCGTGCTGG - Exonic
1180784792 22:18540881-18540903 CTGGGAAATGCTCTTCCTAGAGG + Intergenic
1181128374 22:20714936-20714958 CTGGGAAATGCTCTTCCTGGAGG + Intronic
1181241696 22:21480238-21480260 CTGGGAAATGCTCTTCCTAGAGG + Intergenic
1182795312 22:32987442-32987464 CTGAGAACAGCTCACCCTCCTGG + Intronic
1182897262 22:33869124-33869146 CTGATCAATGCTCATCATTCTGG + Intronic
1184983074 22:48108617-48108639 CTGTGAAACCCTCATCCTGAAGG + Intergenic
949203347 3:1407619-1407641 CTGTGAAATGCTCATTCTTTGGG + Intergenic
949798629 3:7878549-7878571 CTGAGAAATGCTCAGATAGCAGG + Intergenic
949830000 3:8204110-8204132 CTGGGTAATGCTGATGCTGCTGG + Intergenic
949851535 3:8425527-8425549 CAGAGGAAGGCTCATCCTGAAGG + Intergenic
950185831 3:10945006-10945028 CTCAGAAATGCTCTTACAGCGGG + Intergenic
950655033 3:14431339-14431361 CTGAAAAATCCTCATCGTGCTGG + Intronic
954964892 3:54601547-54601569 CTGAGAGGTTCTGATCCTGCAGG - Intronic
956427929 3:69155785-69155807 CTCAGAAATTCTGATCCTGTGGG + Intergenic
957039918 3:75328869-75328891 CTGAGCAATGCACAGCCTTCAGG - Intergenic
958126969 3:89368848-89368870 CTAAGGGATGCTCATACTGCTGG - Intronic
960379908 3:116947266-116947288 CTGACAAAGGCTTTTCCTGCAGG + Intronic
961044695 3:123700406-123700428 CTGAGCAATGCACAGCCTTCAGG - Exonic
962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG + Intronic
963056145 3:141188017-141188039 CTGAGTAATGCTTCTGCTGCAGG + Intergenic
963922853 3:150922733-150922755 CAGAGAAATGCTTTTCCTGCTGG - Intronic
964107091 3:153050990-153051012 CTGGGAAATGTTCATCAGGCAGG - Intergenic
965845231 3:172953462-172953484 CTGAGATTTCCTCTTCCTGCTGG - Intronic
968389224 4:175215-175237 ATGAGGACTGCTGATCCTGCGGG - Intergenic
969156565 4:5216226-5216248 CTAGGAAATGCTGATGCTGCTGG + Intronic
971523891 4:27591116-27591138 CTGAGAAAAGCTCATTTGGCAGG - Intergenic
976757771 4:88516586-88516608 ATGAGAAATTCCCATCCTGAGGG - Intergenic
977749775 4:100595528-100595550 CTGCTGAATGCTCAACCTGCTGG + Intronic
978749901 4:112234157-112234179 ATAAGAAATACTCAACCTGCTGG - Intronic
981906937 4:149932045-149932067 TTGAAAAATGCTCATGCTGTGGG - Intergenic
983028358 4:162766075-162766097 CAGAGAAATGCTCTTCCATCTGG + Intergenic
983412399 4:167417624-167417646 TTGAGAACAGCTCATCCTGAAGG + Intergenic
985044598 4:185927965-185927987 CTGAAAAATACTCATATTGCTGG + Intronic
987025336 5:13921284-13921306 CCCAGGAATGCTGATCCTGCTGG - Intronic
988731000 5:33972488-33972510 CTGAGAAATGCTTGTACTGAAGG + Intronic
989243900 5:39231795-39231817 CTGAGAATTGCTGATTCTGTGGG - Intronic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
991194882 5:63921032-63921054 CTGAGAAATCCACATTCTGTTGG + Intergenic
992912459 5:81410066-81410088 CTCAGAAATTGTCATCTTGCCGG - Intergenic
992981310 5:82176274-82176296 CTCACCAATGCTCTTCCTGCTGG - Intronic
995088062 5:108138986-108139008 CTGATAAATGATTATCTTGCAGG - Intronic
999215882 5:149934703-149934725 CACAGAAATGCTCATCCTAAAGG + Exonic
1001831315 5:174791489-174791511 CTGAGAAATGCTGATTCTGTAGG - Intergenic
1004536036 6:16503256-16503278 CTGAGAAATCCTCAGGCTACTGG + Intronic
1006113272 6:31761645-31761667 CTGGGAAATGCCCAGCCTGGGGG - Intronic
1006751723 6:36382394-36382416 CTGGGTAATGCTGATGCTGCTGG - Intronic
1007194495 6:40048956-40048978 CTGAGCAATGCCCAGCCAGCAGG - Intergenic
1007212707 6:40208349-40208371 CTGAGCGATGCTGATGCTGCTGG - Intergenic
1015154419 6:130075676-130075698 CTCAAAAATGCTCATGGTGCAGG - Intronic
1018212681 6:161497164-161497186 CTGATAAGTGCCCCTCCTGCAGG - Intronic
1019140188 6:169937931-169937953 CTGTGAAATTCTCATCTTCCTGG + Intergenic
1020271975 7:6602312-6602334 CTGAAAAATGGTCATCTTGCTGG + Intronic
1021874150 7:25032891-25032913 CTGAGTCCTGCTCATCCTGCGGG - Intergenic
1022110184 7:27225397-27225419 CTGAGAAAAGCTCAGGCTTCGGG - Intergenic
1022654390 7:32305669-32305691 ATGAGAAATGCTCCTTCTACAGG - Intergenic
1022766559 7:33418724-33418746 CTGGGAAAGGCTTCTCCTGCAGG - Intronic
1028525950 7:91786889-91786911 GAGAGAAATGCTGTTCCTGCAGG - Intronic
1029535807 7:101156833-101156855 CTGAGAAATGGTCGTCCTGTAGG + Intronic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1031678681 7:124643740-124643762 CTCAGACATGCTCATTTTGCAGG + Intergenic
1031969482 7:128053864-128053886 CGGGGAAAAGCTCAGCCTGCCGG - Intronic
1033221889 7:139532431-139532453 CAGAGAAATCCTCAGGCTGCCGG + Intronic
1033510913 7:142059465-142059487 CTGAGTACTGCACATCCTGCGGG - Exonic
1033513722 7:142085826-142085848 CTGAGTACTGCACGTCCTGCGGG - Intronic
1035226963 7:157439012-157439034 CTGGGAGATGCTCACGCTGCTGG + Intergenic
1035327559 7:158074798-158074820 ACGAGCAATGCTGATCCTGCTGG - Intronic
1035643073 8:1198492-1198514 CTGGGGGATGCTCATCCTTCTGG - Intergenic
1036184194 8:6610158-6610180 CTGTTAAATGCTCATGCTTCTGG + Intronic
1037104612 8:15091422-15091444 CTTAGAAATCCTCATCATTCTGG + Intronic
1037287497 8:17317160-17317182 CTGAGGAAAGCTCAACATGCAGG - Intronic
1037636721 8:20706679-20706701 CTGAGCAAAGCTCATCTTCCAGG - Intergenic
1042419193 8:68565263-68565285 CTGACAAAAGCCCATCCTTCAGG - Intronic
1042510547 8:69607070-69607092 CTCAGGGATGCTGATCCTGCTGG - Intronic
1043002359 8:74774514-74774536 CTGAGAGATGCTCTGCCAGCTGG + Intronic
1045791690 8:105991296-105991318 CTGAGAAATGCTAACCCAGGTGG - Intergenic
1046773279 8:118137544-118137566 CTGAGGGATGCACATCCTGGTGG - Intergenic
1048406196 8:134124676-134124698 CTGAGAAGTGCTGTTCTTGCAGG - Intergenic
1048827294 8:138440752-138440774 CTGAGATATACTCATACTGTAGG + Intronic
1048889031 8:138931614-138931636 CTGAGAAAAGCCCCTCCTGTGGG + Intergenic
1049681394 8:143920142-143920164 CTGAGTAGAGCTCCTCCTGCCGG + Exonic
1050191703 9:3033320-3033342 CTGAGCCCTTCTCATCCTGCAGG - Intergenic
1053674558 9:40411052-40411074 CGGTGAAAAGCTCATCCTGTGGG - Intergenic
1055437567 9:76307899-76307921 AAGAGAAATGGTCATCCGGCCGG + Intronic
1058269017 9:102945926-102945948 CTCAGAACTGCACATCATGCAGG + Intergenic
1058826959 9:108783659-108783681 CAGAGTTATTCTCATCCTGCTGG - Intergenic
1059393293 9:114013881-114013903 TGGAGAAATTCTCATCCTGTAGG - Intronic
1060461460 9:123858718-123858740 CTGAGAAATGATCAGTCTGTAGG + Intronic
1060870517 9:127036181-127036203 CTGGGAAATGGTCTTCCTGCTGG + Intronic
1185925051 X:4136666-4136688 CTGAGAATAGTTCTTCCTGCAGG + Intergenic
1186487317 X:9943347-9943369 CTGCCTAATGCTCATCCGGCTGG + Intronic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1187949575 X:24458561-24458583 CTGAAAAAGCCACATCCTGCAGG + Intergenic
1191152839 X:57239524-57239546 CTTGGAAATGGTCATCTTGCAGG + Intergenic
1192935165 X:75851112-75851134 CTGAGAACTCCTCAGTCTGCTGG - Intergenic
1199636452 X:149817367-149817389 GTGAAAACTGCTCTTCCTGCTGG + Intergenic
1199708433 X:150451029-150451051 CTGAGCACTGCTCAGCTTGCAGG + Intronic
1201977190 Y:19864756-19864778 CTGAAGAATGCTCTTCCTGTGGG - Intergenic
1202369797 Y:24188828-24188850 ATGAGAAATGTTCACCCTCCTGG - Intergenic
1202500987 Y:25481289-25481311 ATGAGAAATGTTCACCCTCCTGG + Intergenic