ID: 1175877897

View in Genome Browser
Species Human (GRCh38)
Location 20:62238893-62238915
Sequence GGTCCCGGGATCGCAGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175877897_1175877920 30 Left 1175877897 20:62238893-62238915 CCGGCAACTGCGATCCCGGGACC No data
Right 1175877920 20:62238946-62238968 CCCCTGCTGCCCCGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175877897 Original CRISPR GGTCCCGGGATCGCAGTTGC CGG (reversed) Intronic