ID: 1175877897 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:62238893-62238915 |
| Sequence | GGTCCCGGGATCGCAGTTGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175877897_1175877920 | 30 | Left | 1175877897 | 20:62238893-62238915 | CCGGCAACTGCGATCCCGGGACC | No data | ||
| Right | 1175877920 | 20:62238946-62238968 | CCCCTGCTGCCCCGCTGAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175877897 | Original CRISPR | GGTCCCGGGATCGCAGTTGC CGG (reversed) | Intronic | ||