ID: 1175878161

View in Genome Browser
Species Human (GRCh38)
Location 20:62240205-62240227
Sequence CTCAACAAGGGGAAGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175878161_1175878169 -3 Left 1175878161 20:62240205-62240227 CCAGTTACCTTCCCCTTGTTGAG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1175878169 20:62240225-62240247 GAGGACAGGAACTTTGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1175878161_1175878168 -6 Left 1175878161 20:62240205-62240227 CCAGTTACCTTCCCCTTGTTGAG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1175878168 20:62240222-62240244 GTTGAGGACAGGAACTTTGTCGG 0: 1
1: 0
2: 1
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175878161 Original CRISPR CTCAACAAGGGGAAGGTAAC TGG (reversed) Intronic
900890860 1:5448733-5448755 CTCAGCAGGGGTAAGCTAACAGG - Intergenic
901020304 1:6251955-6251977 CTCAAAAAGGGGATGGCAGCCGG - Intronic
901978290 1:13012645-13012667 CTCATCAAGGGGAACGTGGCAGG + Intronic
902003794 1:13216293-13216315 CTCATCAAGGGGAACGTGGCAGG - Intergenic
902023019 1:13362037-13362059 CTCATCAAGGGGAACGTGGCAGG - Intergenic
902548544 1:17205650-17205672 CTCAAGATGGGGAAGAGAACTGG + Intronic
903001273 1:20267670-20267692 TTCAACAAAGGGAAGGCTACTGG - Intergenic
903372953 1:22848638-22848660 GTCAACAGGAGGAAGGTGACGGG + Intronic
903500513 1:23797785-23797807 CTCATCAAGGGGCAGGTACTGGG + Exonic
906311570 1:44758126-44758148 ATCTACAATGGGAAGGTAGCTGG + Exonic
908300843 1:62759652-62759674 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
910774175 1:90858465-90858487 ATGAACAAAGGGAAGTTAACAGG + Intergenic
912642604 1:111361615-111361637 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
919113936 1:193257579-193257601 GGCAACAAGGAGAAGGTAACCGG + Intergenic
920138674 1:203791374-203791396 CTAAGCAAGGGCATGGTAACAGG - Intergenic
1064927247 10:20582473-20582495 CACAACAGGTGGAAAGTAACAGG + Intergenic
1067793351 10:49303850-49303872 CTCAGCCAGGGGAAGGAAAGGGG - Intronic
1068203489 10:53815303-53815325 CTCAACAACTGGAATGTAACAGG - Intronic
1069200793 10:65613276-65613298 CTGAACAAGGGGAAGTTTGCAGG - Intergenic
1069359870 10:67629975-67629997 CTCAAAAAGAGGATGCTAACGGG + Intronic
1069418870 10:68227882-68227904 ATCAAGATGGGAAAGGTAACTGG - Intergenic
1070531295 10:77339615-77339637 CTCCACTAGGGGAGGGTTACTGG + Intronic
1070799732 10:79238206-79238228 TTCTACAAGGGCAAGGTTACTGG - Intronic
1072130882 10:92492781-92492803 TTCAACAAGGGGCAGGTATTTGG - Intronic
1072496597 10:95967282-95967304 CTAAACAAGGGGAAGAATACAGG + Intronic
1073785785 10:106888305-106888327 CTCAACAATTGGAAGGTATTTGG + Intronic
1075124495 10:119688878-119688900 ATCAACAAGGTTAGGGTAACAGG + Intergenic
1076568719 10:131417100-131417122 ATCCACAGGGGGAAGGGAACAGG - Intergenic
1077368939 11:2172642-2172664 CTCTCCAAGGGGAAGGCATCAGG - Intergenic
1078673336 11:13385098-13385120 CTCAGCCAGGGGAAGGCAGCTGG + Intronic
1082969598 11:59005503-59005525 CTCAGCAAGGGGAATGTGGCAGG - Intronic
1083478532 11:62928938-62928960 TTCAACACTGGGAAGGGAACAGG + Intergenic
1083959391 11:66006144-66006166 CTCAACAATAGAAAGATAACAGG + Intergenic
1084274698 11:68045289-68045311 CTCAACAAGGGGGAGTTGGCTGG - Intronic
1088542101 11:110923845-110923867 CTCAACCAGGTGAAGGAAAATGG - Intergenic
1088611337 11:111580158-111580180 CTCCACAGGGAGAAGATAACTGG + Intergenic
1088840557 11:113624162-113624184 CTCAAAATGGGGAAGTTAATGGG - Intergenic
1096055182 12:48644680-48644702 ATCAACAAGTGAAAGGTAAGGGG + Intergenic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1099463614 12:82955199-82955221 CACAACTTGGGGAATGTAACTGG - Intronic
1107118492 13:36773048-36773070 CTCAACAAGGAGTAGGTTCCAGG - Intergenic
1108849040 13:54705614-54705636 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
1113663531 13:112124527-112124549 CTCAAAAAGAGAGAGGTAACTGG - Intergenic
1115104783 14:29747283-29747305 AACAAAAAGGGGAAAGTAACAGG + Intronic
1115388621 14:32827650-32827672 CACATCAAAGGAAAGGTAACTGG + Intronic
1115427724 14:33280065-33280087 CTCAAGAACTGCAAGGTAACAGG - Intronic
1117102977 14:52369417-52369439 CACTAGAATGGGAAGGTAACAGG - Intergenic
1117121794 14:52575898-52575920 CTCCACTAGGAGAAGATAACTGG - Intronic
1123052908 14:105555585-105555607 CTCAGCAAGGGGAATGCAGCAGG - Intergenic
1125649017 15:41298087-41298109 TTCAAAAACGGGAAAGTAACTGG - Intergenic
1125695577 15:41634592-41634614 CTCAGTAAGGGGAAGGAAAGGGG - Intronic
1126461525 15:48919883-48919905 CACACCAAGGGGAAGATATCTGG - Intronic
1149535167 17:57428004-57428026 CTCAGCAAGGGGAATGCAGCAGG + Intronic
1151269325 17:72981085-72981107 ATCACCAAGGGGAAGGAAACAGG + Intronic
1152011674 17:77722708-77722730 CTCTTCAAGGTGAAGATAACAGG + Intergenic
1153763755 18:8355639-8355661 CTTAACAAGGAAAAGGTTACTGG + Intronic
1154346311 18:13546211-13546233 CTCATCAAGTGGAAGGTCAAGGG + Intronic
1157578853 18:48761675-48761697 CTCAACATGCTGCAGGTAACTGG + Exonic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162278521 19:9676994-9677016 CTCAGCAAGGGGAATGCAGCAGG + Intergenic
1163785417 19:19272647-19272669 CTGAACAAGAGGAAAGTCACAGG + Intronic
1164583696 19:29451723-29451745 CTGAACATGGGAAAGGTAGCTGG + Intergenic
1167055777 19:47111264-47111286 CTCGAGCAGGGGAAGGAAACGGG + Intronic
925103430 2:1268978-1269000 CTCATCTATGGGAAGGTGACAGG + Intronic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
927841002 2:26444043-26444065 ATCAACAAAAGGAAGGCAACAGG - Intronic
927922500 2:26983942-26983964 CCCAACAAGGGGAAGGGACGGGG - Intronic
930017167 2:46978897-46978919 CTGAAGAAGGGGTAGGTCACTGG + Exonic
932044135 2:68330348-68330370 CTCAACAAGTGGCACATAACAGG - Intergenic
935126562 2:100229009-100229031 GTCAATGAGGGGAAGGTAAAGGG + Intergenic
935842050 2:107124044-107124066 TACTACAAAGGGAAGGTAACAGG + Intergenic
940020254 2:149148746-149148768 CTCAACAAGAGGAGGCAAACTGG - Intronic
946774014 2:223118723-223118745 CCCAACCAAGGGAAGGTCACCGG - Intronic
1172337354 20:34128311-34128333 CTCAGCAAGGGGAATGTGGCGGG - Intergenic
1172471106 20:35196928-35196950 AACAACAGGGGGAAGGTAAAGGG + Intergenic
1175878161 20:62240205-62240227 CTCAACAAGGGGAAGGTAACTGG - Intronic
1176257833 20:64161668-64161690 CTCCACACGGGGAGGGAAACGGG - Intronic
1177060353 21:16365916-16365938 CTCACCAAGGGAAAATTAACAGG - Intergenic
1177254423 21:18642300-18642322 CTCAACATTGTGAAGCTAACTGG + Intergenic
1179287202 21:39987755-39987777 CTCAGCAAGGAGAAGGAAATAGG + Intergenic
1184250271 22:43256249-43256271 CTCAACAAGGGGATGCAAAGAGG + Intronic
952357936 3:32601961-32601983 CTGAACAAGGGGAAGACAGCAGG - Intergenic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955926526 3:64011407-64011429 CTAAACAAGTGGAAGGGAAGGGG + Intronic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
959359215 3:105367918-105367940 CTCACCAAGGGGAAGTTACTAGG - Intronic
960496198 3:118377941-118377963 CTCCACAAGGAGAAGATAATTGG + Intergenic
962648366 3:137463027-137463049 ACTAACAAGGGGAAGGTCACAGG - Intergenic
963607869 3:147427798-147427820 GGCAAAAAGGGGAAGGGAACAGG - Intronic
964642055 3:158918948-158918970 CTTAAAATGGGGAAGGTTACTGG + Intergenic
967074612 3:185990802-185990824 CTCAACAAGGGTAAAGTCAAGGG + Intergenic
968328247 3:197840888-197840910 CTCAAGGTGGGGAATGTAACTGG - Intronic
968396324 4:241975-241997 CTCAGCAAGGGGAATGTGGCAGG - Intergenic
971571769 4:28221565-28221587 ATCGACAAGGGGAAGTGAACAGG - Intergenic
972025099 4:34365638-34365660 CTCAACAACTGAAAGATAACAGG - Intergenic
973343483 4:49029877-49029899 CTCAGCAAGGGGAATGCAGCAGG - Intronic
977982777 4:103345008-103345030 TTTATCATGGGGAAGGTAACTGG - Intergenic
979717842 4:123863019-123863041 CTGAACAAGGGGAAAGTATGAGG - Intergenic
982701554 4:158663365-158663387 ATCAAAAAGGGGAAGGTGAGGGG + Intergenic
983694651 4:170513302-170513324 CTCAAAAAGGGGGAGGTATGCGG + Intergenic
985675576 5:1229814-1229836 CTGAACAGGGGAAAGGTAAGAGG + Intronic
990570871 5:57077335-57077357 ATCAACAACAGAAAGGTAACTGG - Intergenic
991640655 5:68748512-68748534 CCCAACATGGGGAAAATAACAGG - Intergenic
993894713 5:93520496-93520518 CTCAACAAGAGGAAGTATACAGG + Intergenic
995938401 5:117547426-117547448 CTGAACTTTGGGAAGGTAACAGG + Intergenic
997357405 5:133272119-133272141 CCCAACAAGGGGAATGTACCAGG + Intronic
998397454 5:141827867-141827889 CTCAACAAGAGGAGGGTGGCTGG - Intergenic
999255660 5:150208836-150208858 CTCTACAAGGGAAAGGTCAGAGG + Intronic
1003559672 6:7170362-7170384 AGCAACAAGGGGCAGGTGACGGG - Intronic
1006063647 6:31444626-31444648 CTGAACACAGGGAAGCTAACAGG + Intergenic
1007571419 6:42893871-42893893 CTCAGCAAGGGGAATGCAGCAGG + Intergenic
1007996396 6:46312619-46312641 TTCAACAAGGGTAAGGTTTCTGG - Intronic
1008547298 6:52594478-52594500 CTGAACAAGGGGTAGGGAACAGG + Intergenic
1009908814 6:69902148-69902170 CTCAACAAGTGAAATGTAAGTGG - Intronic
1010984661 6:82410222-82410244 CACAACATGGTGAAGGTCACAGG + Intergenic
1013827094 6:114226473-114226495 ATCAACAAGGGGAAGTTAAGTGG - Intronic
1016061504 6:139635987-139636009 CTCCCCAAAGGGAAGGAAACAGG - Intergenic
1017379194 6:153807853-153807875 CCCAACTAGGGGAAGGTAAGAGG - Intergenic
1018211674 6:161488290-161488312 GTCAACAAGGGGAAAGTGATCGG + Intronic
1018358827 6:163045152-163045174 CTCAGGAAGGGGGAGGTACCTGG + Intronic
1019986445 7:4659779-4659801 CTTAAAAAGGGGCAGGAAACAGG - Intergenic
1021401688 7:20217156-20217178 TTAAATAAAGGGAAGGTAACTGG - Intronic
1022563402 7:31373173-31373195 ATCAGCAAGGGGCAGGGAACAGG - Intergenic
1023197295 7:37655371-37655393 GTCCACAAGGGAAAGGGAACTGG + Intergenic
1027562587 7:79751023-79751045 CTCAGCAAGGGGAATGCAGCGGG + Intergenic
1028565291 7:92223780-92223802 CTAAACTGGGGGAAGGAAACTGG - Intronic
1031445770 7:121851807-121851829 CCTAACAAGGGGAAGTAAACTGG + Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1038205067 8:25458191-25458213 CCCAAGAACGGAAAGGTAACGGG - Exonic
1039257938 8:35739633-35739655 TTCAATAAGGGGAAAGTCACTGG + Intronic
1044343206 8:91071053-91071075 ACCAATAAGGGGATGGTAACGGG - Intronic
1056859518 9:90167059-90167081 CTTAGCAAGGGGAGTGTAACAGG - Intergenic
1187932061 X:24302657-24302679 CTTAACAAGGCCAGGGTAACAGG + Intergenic
1189084460 X:38006390-38006412 ATCAGCAGGGGAAAGGTAACAGG - Intronic
1191018443 X:55835411-55835433 CTCAGCAAGGGGAATGTGGCAGG + Intergenic
1197635391 X:128909106-128909128 TTCAATAAGGGGAAGGCCACTGG - Intergenic
1198842876 X:140877935-140877957 CCAAACAAGGATAAGGTAACTGG - Intergenic
1201787327 Y:17799521-17799543 CTTAACAAGGGAATGGTAGCAGG + Intergenic
1201814226 Y:18106467-18106489 CTTAACAAGGGAATGGTAGCAGG - Intergenic