ID: 1175879102

View in Genome Browser
Species Human (GRCh38)
Location 20:62246379-62246401
Sequence CTTAGACTCTCCCATGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175879102 Original CRISPR CTTAGACTCTCCCATGGCAC TGG (reversed) Intronic
901818882 1:11812781-11812803 CTTTGTCTCTCCCAAAGCACAGG + Intronic
901831041 1:11892649-11892671 TTTAGTGTCTCCCCTGGCACAGG + Intergenic
909151665 1:72013382-72013404 CTTGGTCTCTCCCAGAGCACTGG - Intronic
910624339 1:89290720-89290742 CCTTGCCTCTCCCATGACACAGG + Intergenic
917514943 1:175699491-175699513 CATTCACTCTCCCATTGCACTGG - Intronic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
1066245103 10:33575313-33575335 CTTAGAGTCTCCCATGAGATTGG + Intergenic
1069290907 10:66778589-66778611 GATAGACACTCACATGGCACAGG + Intronic
1074442419 10:113490074-113490096 CTTAGACTCCCCTATGCCCCTGG - Intergenic
1077866938 11:6230201-6230223 CTTTGCCTCTCCCAGGGCAAAGG - Intronic
1078705094 11:13735869-13735891 GTTAGACGTTCCCATAGCACAGG - Intergenic
1086450897 11:86915797-86915819 CTTAGTCTCTCCCAAAGCGCTGG - Intronic
1089097104 11:115928182-115928204 CTTAGGCTCTCACATGGTCCTGG + Intergenic
1089324746 11:117649503-117649525 CTTTGACTCTCCCATCTCCCTGG + Intronic
1090171506 11:124610205-124610227 CTCAGACTCTCCCAAGCCCCTGG + Intergenic
1093691652 12:22115929-22115951 CTTAGACACTACCATGGGGCTGG - Intronic
1094494681 12:30982041-30982063 CCCAGACCCGCCCATGGCACTGG - Intronic
1095970800 12:47900932-47900954 CTTAGTCTATTCCCTGGCACAGG + Intronic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102901866 12:116645158-116645180 GCTAGACTCTCACATGGCAATGG - Intergenic
1107959342 13:45544671-45544693 CTTGGACTGGCCCATGCCACAGG - Intronic
1110660299 13:78053070-78053092 CTTAGGCACTGCCATGGCCCTGG + Intergenic
1111579626 13:90206559-90206581 CTTATACTCTCCCATCATACAGG + Intergenic
1116034961 14:39616619-39616641 CTGAGACACTGTCATGGCACTGG - Intergenic
1116195713 14:41722928-41722950 ATTTGATTCTCCCTTGGCACTGG - Intronic
1117492379 14:56262737-56262759 CTAACTCTCTCCCCTGGCACAGG + Intronic
1119558519 14:75571615-75571637 TCTAGACTCCCCCATGGCACAGG + Intergenic
1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG + Intergenic
1129332612 15:74835527-74835549 CTTAGACTTACCCATGCCCCCGG - Intergenic
1129888082 15:79052631-79052653 CCAAGGCTCTCCCATGGCAGTGG - Intronic
1130775179 15:86971810-86971832 CTTGGTCTCTCCCTTGACACAGG - Intronic
1132002909 15:98197736-98197758 CCTAGACCCTCCCATAGTACAGG + Intergenic
1132610146 16:811819-811841 CTCAGCCTCTCGCATGGGACTGG - Intronic
1138297383 16:55898738-55898760 CTCAGCCTCTCCCATGGTGCTGG - Intronic
1141062871 16:80890837-80890859 CATACACTCTCCCAGGGAACTGG + Intergenic
1141409525 16:83823203-83823225 TTCTGACTCTGCCATGGCACAGG + Intergenic
1142284261 16:89165353-89165375 CTGCCACTGTCCCATGGCACAGG + Intergenic
1142782264 17:2190428-2190450 CTAAGACACTCCCATGACCCTGG + Intronic
1146378759 17:32313051-32313073 CTTGGCCTCTCCCAAAGCACTGG + Intronic
1148237001 17:45975736-45975758 CTTTGACTGTCACATGGGACTGG - Intronic
1148623973 17:49054862-49054884 CTCAGACTCCCCCAGGGCAAAGG - Exonic
1151616801 17:75218453-75218475 TTTAGACTCTCCCATAGAGCAGG - Intronic
1151771258 17:76163547-76163569 CTTAGACACTGACATGGCCCAGG - Intronic
1152741404 17:82020024-82020046 CTGAGCCTCTCCCAGGGCAGGGG + Intronic
1155446130 18:25914712-25914734 CTTAGATTCTTCGTTGGCACTGG - Intergenic
1155733531 18:29192305-29192327 CTCTGACTCTCCCAAAGCACAGG + Intergenic
1158134471 18:54191202-54191224 CTGAGTCTCACCCCTGGCACTGG + Intronic
926555713 2:14355513-14355535 CTTTGTCTCTCCCAAAGCACAGG + Intergenic
926961508 2:18363233-18363255 TATAGACTCAGCCATGGCACTGG - Intergenic
927603311 2:24463458-24463480 CTTAGGATTTCCCAGGGCACTGG - Intergenic
933656550 2:84891833-84891855 CTTTGACGCTCCCATGGCCACGG - Intronic
936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG + Intergenic
936191896 2:110340612-110340634 CTCACACTCTCCCATGGCTGGGG - Intergenic
938936078 2:136128664-136128686 CTCATACTCTCACATGGCCCGGG + Intergenic
946438257 2:219673813-219673835 CTTTTATTCTCCCATGGCAATGG + Intergenic
947352057 2:229256505-229256527 CTTGGAAACTCCCAGGGCACTGG + Intronic
948346845 2:237305872-237305894 CTTATCCTGTCCCATGGCCCAGG - Intergenic
948788248 2:240364258-240364280 CTGAGATTCTGCCATGGAACGGG + Intergenic
1170933707 20:20792090-20792112 CTTACTCTCTCCCCTGGCTCAGG + Intergenic
1173443048 20:43095137-43095159 CTTTGTCTCTCCCAAGGCAGAGG - Intronic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1176148693 20:63577648-63577670 CTTAGAGTCTTCCATGGCACAGG - Intergenic
1178097749 21:29234208-29234230 CCTAGACTCTGCCGTGGGACAGG - Intronic
1178765448 21:35446532-35446554 ATGAGCCTTTCCCATGGCACAGG + Intronic
950504201 3:13383936-13383958 CTTACAGTCTCCCAGGGCAGCGG - Intronic
951284415 3:20791285-20791307 AGTAGATTCTCCCTTGGCACTGG + Intergenic
954938140 3:54345759-54345781 CTTAGACTCTTCCACAGCAAAGG - Intronic
955609221 3:60739373-60739395 CCTAGACACTACCATGGGACTGG + Intronic
956390873 3:68771375-68771397 CCTAGACACTGCCATGGGACTGG + Intronic
956711140 3:72039778-72039800 CTTAGAGTTTCCAGTGGCACAGG - Intergenic
961546656 3:127639037-127639059 CTTAGACTTCCCTATGGCAGGGG - Intronic
962911488 3:139855486-139855508 ATTGGATTCTCCCTTGGCACTGG - Intergenic
965397611 3:168178236-168178258 CTTTGACTCTTCTATGTCACTGG - Intergenic
966849455 3:184155628-184155650 CTTGGTCTCGCCCATGGCTCTGG - Exonic
969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG + Intronic
971202315 4:24521964-24521986 CCCAGTCTCTCCCATGACACAGG + Intronic
972879373 4:43405572-43405594 CTTGGTCCCTCCCATGACACAGG - Intergenic
983561283 4:169104172-169104194 CCCAGACTCTCCCTAGGCACTGG - Intronic
984997728 4:185452177-185452199 CTCAGACTCAGCCATGACACTGG + Intronic
986146434 5:5082393-5082415 CTCTGACTCTCCCAAAGCACAGG + Intergenic
986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG + Intergenic
987720701 5:21628569-21628591 CTTATACTGTCCCATAGCATTGG - Intergenic
991482876 5:67102055-67102077 CTGAAAGTCTTCCATGGCACAGG - Intronic
992259708 5:74957456-74957478 CCTAGACTCTTCCATGTCACTGG + Intergenic
995648856 5:114344697-114344719 CTTAGACTCTCCCAAGTGATAGG - Intergenic
998393702 5:141804684-141804706 CTGAGACTCTCCCAAGGCAGCGG + Intergenic
1002129331 5:177070419-177070441 CTGAGACCCTCCCTAGGCACTGG - Intronic
1006591360 6:35160384-35160406 CCTACACTCTGCCGTGGCACTGG + Intergenic
1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG + Intergenic
1007095989 6:39213544-39213566 CTAAGGGTCTCCCATGCCACAGG + Intronic
1008323419 6:50146874-50146896 ATTAGACTCACCCCAGGCACAGG + Intergenic
1008553014 6:52651146-52651168 CTCAGATGCTCCCTTGGCACTGG + Intergenic
1016759684 6:147723392-147723414 CTTTGGCTCTGCCATGGAACAGG + Intronic
1018486784 6:164248880-164248902 CTGATACTCTCCCATGACAGGGG - Intergenic
1020254521 7:6495371-6495393 CTTAAAATCCCCAATGGCACTGG - Intergenic
1020950783 7:14674466-14674488 CTTAGAATCTGCCATGGCCATGG + Intronic
1023350617 7:39316981-39317003 CTGAGACAATCCCATGTCACTGG - Intronic
1024479599 7:49850336-49850358 CTTGGACTCACCAATGGAACTGG - Intronic
1026087112 7:67271515-67271537 CTCAGACTCTGGAATGGCACTGG - Intergenic
1026248450 7:68645183-68645205 CCTAGACACTGCCATGGGACTGG + Intergenic
1026689986 7:72543184-72543206 CTCAGACTCTGGAATGGCACTGG + Intergenic
1027508749 7:79052521-79052543 CTTGGATGCTCCCATGCCACTGG + Intronic
1029374901 7:100171588-100171610 CGGAGACTCTCGCATGGCAGCGG - Exonic
1029722769 7:102380674-102380696 CTCAGACTCTGCCATGGAAGTGG - Intronic
1034830416 7:154303624-154303646 CTTAGACTCCTGCATGGGACAGG - Intronic
1036439325 8:8766300-8766322 CTCAGACTCTACCAGGCCACTGG + Intergenic
1036573699 8:10004450-10004472 CAGAGCCTCTCCCATAGCACTGG + Intergenic
1037433558 8:18839787-18839809 CTATAACTCTCCCATGACACAGG + Intronic
1039230340 8:35439624-35439646 CTTAGTCTATCCCATGGCTTTGG - Intronic
1045412888 8:101936715-101936737 ATTAGAATCTCCCAGAGCACTGG - Intronic
1046775914 8:118163535-118163557 CTTTGACTCTCCAAAGGCATGGG - Intergenic
1049302644 8:141879741-141879763 CTGAGACCATCCCATGGCAAGGG - Intergenic
1051056632 9:12995033-12995055 CTTACACTCTCCAAGTGCACTGG + Intergenic
1052006138 9:23351092-23351114 CTTGTAATCTCCCATGGGACAGG - Intergenic
1054451153 9:65404216-65404238 CTGGGACCCTCCCAGGGCACTGG + Intergenic
1055045982 9:71924192-71924214 CTTAGACTTTCCCATAGCTTTGG + Intronic
1055449607 9:76418977-76418999 TTTTGTCTCTCCCAAGGCACAGG - Intergenic
1056262649 9:84864180-84864202 CTCTGACTCTCCCCTGGCCCAGG - Intronic
1057618152 9:96611919-96611941 CTCAGGCTCTCCCATGGTAGAGG + Intronic
1057987866 9:99735462-99735484 CATAGACTCTTCCAGGGCAGAGG - Intergenic
1058149284 9:101446397-101446419 CTCAGACTCTCCCCTAGCATTGG - Intergenic
1187133350 X:16524293-16524315 CTGAGAGTCTCCCAGCGCACTGG + Intergenic
1192830233 X:74743504-74743526 CTTAGACTCTCGCTTGGGGCAGG + Exonic
1197997320 X:132391904-132391926 CATAGACTGTGCGATGGCACAGG - Intronic
1198822149 X:140659775-140659797 CTTAGGCTTTCCCACGGCAGTGG + Intergenic
1198872955 X:141194682-141194704 CTTGGTCCCTCCCATGACACAGG - Intergenic
1199575641 X:149311474-149311496 CCTAGACACTACCATGGGACTGG - Intergenic