ID: 1175880926

View in Genome Browser
Species Human (GRCh38)
Location 20:62258554-62258576
Sequence CAGAAAATACAGATGAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175880926_1175880928 21 Left 1175880926 20:62258554-62258576 CCTTTGCTCATCTGTATTTTCTG 0: 1
1: 1
2: 2
3: 58
4: 499
Right 1175880928 20:62258598-62258620 TGGTGTCTTAGAATGTTATTAGG 0: 1
1: 0
2: 1
3: 15
4: 196
1175880926_1175880927 1 Left 1175880926 20:62258554-62258576 CCTTTGCTCATCTGTATTTTCTG 0: 1
1: 1
2: 2
3: 58
4: 499
Right 1175880927 20:62258578-62258600 TTTTCTACAATAAATGCATGTGG 0: 1
1: 2
2: 2
3: 33
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175880926 Original CRISPR CAGAAAATACAGATGAGCAA AGG (reversed) Intronic
900961098 1:5920654-5920676 CAGAAAAGAAAAATGGGCAAAGG - Intronic
901641656 1:10695679-10695701 CAGAAAAGAAAGAGGAGCACGGG - Intronic
903509650 1:23865633-23865655 CAGCAAAACCACATGAGCAAAGG + Intronic
903549159 1:24145679-24145701 TAGGAAATGCAGATAAGCAAAGG - Intergenic
903669985 1:25029728-25029750 TAGAAAATACAGATAAGCACAGG - Intergenic
907841647 1:58163707-58163729 CTGAAAATACACTTGAGCATGGG - Intronic
907858740 1:58329147-58329169 CAGAAAATGTAGATAAGCAAAGG + Intronic
908793647 1:67809351-67809373 GAGAAAATGTAGATGACCAAGGG + Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
908933659 1:69347285-69347307 CATAAAATACAAATGATCATTGG + Intergenic
909700987 1:78522672-78522694 CAGAAAAGAGGGATGAGGAAAGG + Intronic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
911705897 1:101012343-101012365 CAGAAAAGAGGGATGAGGAAGGG + Intronic
911708051 1:101038148-101038170 CAGAAAACAGAGTTCAGCAAGGG - Intergenic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
913144232 1:115973794-115973816 CAAAAAATAAAAATGAGCCATGG + Intergenic
913156546 1:116105147-116105169 CAGAAATAACAGCTGGGCAAAGG - Intergenic
913392227 1:118326873-118326895 CAGAAAATAGAAATGAACATTGG + Intergenic
913514434 1:119591176-119591198 AAGAAAGAACAGAGGAGCAAAGG + Intergenic
915789498 1:158652690-158652712 GAGAAAATACAGAAGAGTAGAGG + Intronic
915812625 1:158930816-158930838 GAAAAAATACTGCTGAGCAAAGG + Intronic
917363516 1:174203272-174203294 CATCATATACAAATGAGCAATGG - Intronic
917626912 1:176855526-176855548 CATAAAAAAATGATGAGCAATGG + Intergenic
917753131 1:178072638-178072660 CTGAAAATACAGGTTAGAAAGGG - Intergenic
918230987 1:182531628-182531650 GAGGAAATACAGAGGAGAAAAGG - Intronic
918553936 1:185777134-185777156 CAGAAAATAAGGATCAGAAAAGG - Intronic
918765126 1:188472210-188472232 CAGAAAATTTAGATGAGGCATGG - Intergenic
918942612 1:191020848-191020870 CAGTAAATAAACATTAGCAAGGG + Intergenic
919533402 1:198754519-198754541 AAGAAAATAGAGAAGAGAAAAGG - Intronic
919563547 1:199155406-199155428 TAGAAAAGACATTTGAGCAATGG - Intergenic
921552531 1:216555198-216555220 AAAAGCATACAGATGAGCAAAGG + Intronic
921629865 1:217420291-217420313 GAGAAAAGACAGATGATTAAAGG - Intergenic
922273959 1:224059271-224059293 CTGAAAATAGAGAAGAGGAAAGG + Intergenic
924105861 1:240648579-240648601 AAGAGAATACAAATAAGCAAAGG - Intergenic
924542773 1:244996816-244996838 AAGAAAAAACAGTTGAGCAGAGG - Intronic
924646559 1:245883103-245883125 CAGAAAAGACAAATGTGAAAAGG + Intronic
1063684115 10:8220173-8220195 AAGAAAATAAAGAAGAGAAAAGG + Intergenic
1064917307 10:20474272-20474294 AAGAAACCACAGATGTGCAAAGG + Intergenic
1065473725 10:26111286-26111308 CAAAGACTACAGATGAGCTAGGG + Intronic
1065900570 10:30203991-30204013 CAGAAAACAAAGAAGAGCACAGG + Intergenic
1066343285 10:34557351-34557373 TAGAAAATACAAAAGAGCCAGGG + Intronic
1066475914 10:35747188-35747210 GAGAAAGTACAGGAGAGCAACGG + Intergenic
1067214592 10:44292288-44292310 AAGAAAATAAAGAAGAGAAAAGG + Intergenic
1068706541 10:60082693-60082715 CAGAAAAGACAGACGACCACAGG + Exonic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069180890 10:65357210-65357232 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1069364334 10:67681342-67681364 CAGGAAAGACAGCTGAGAAATGG + Intronic
1069537261 10:69263853-69263875 TAAAAAATACAGATAAACAAAGG + Intronic
1070385640 10:75921887-75921909 CAGAAAATAGAGGTGGGCAAGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070972372 10:80578177-80578199 CAGAAATTCCAGATGAGCCTGGG - Intronic
1071407695 10:85354796-85354818 CAGAAAAAATACATGTGCAAGGG + Intergenic
1071450201 10:85786704-85786726 CAGTAATTACAGATGGGAAAGGG + Intronic
1071588634 10:86849842-86849864 AATAAAATTCAGATGAGGAAAGG - Intronic
1071868859 10:89769331-89769353 CAGAAAACAGGGATGAGGAAGGG - Intronic
1071889490 10:89987554-89987576 CACAAGATACAGGTGAGGAAGGG - Intergenic
1074709740 10:116167334-116167356 GAGAAAATACGGAGGGGCAAAGG - Intronic
1076102075 10:127790618-127790640 CAGGGAAGACAGATAAGCAATGG - Intergenic
1076294139 10:129371405-129371427 CCGGAAAAACAGAGGAGCAAAGG + Intergenic
1076479096 10:130772652-130772674 CAGGAGATTCAGATGGGCAAAGG - Intergenic
1077385105 11:2265722-2265744 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1077406606 11:2385227-2385249 CAGTAAATACAGATGTTTAAGGG + Intronic
1077775646 11:5268751-5268773 CAAAAAATTCAGATGAGCTTAGG + Intronic
1078494343 11:11801032-11801054 CAGAAAAAAAAGAGGAGCTAGGG + Intergenic
1079379308 11:19923161-19923183 CAGAAAAGACAGATGTCCACTGG - Intronic
1080435479 11:32237521-32237543 CAGAAAAGAATGAAGAGCAATGG + Intergenic
1081144146 11:39540751-39540773 CAGAATGTACAGATGAGAACTGG - Intergenic
1082797184 11:57386825-57386847 CAGAGAATGCAGTTGAGGAAGGG + Exonic
1083034871 11:59627778-59627800 GAGAAGAGACAGATGTGCAAAGG - Intergenic
1086429072 11:86717803-86717825 AACAAAAGACAGATTAGCAAGGG + Intergenic
1086575365 11:88333841-88333863 CAGCAAATCCAGTTGAGGAAAGG + Intronic
1086682369 11:89688289-89688311 CAACAAATACAGATGATAAATGG + Intergenic
1087090047 11:94260336-94260358 CAGAAACTACAGAAATGCAAAGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087563939 11:99829503-99829525 CATAAAATAAAGAAGAGAAATGG + Intronic
1087678927 11:101196187-101196209 TAGAAAATACAGAAAAGCAGTGG + Intergenic
1087693426 11:101348308-101348330 CAGGAAATTGAGCTGAGCAACGG + Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089098781 11:115942324-115942346 CAGATTCTACAGATGAGAAAAGG + Intergenic
1090197616 11:124830498-124830520 AAGAAAAGAGAGATGAGCAAAGG + Intergenic
1090501326 11:127264440-127264462 TAGAAAATGCAGAAGTGCAAGGG + Intergenic
1091064672 11:132498308-132498330 AAGAAAAAACAGATGACCAATGG - Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092779780 12:11974861-11974883 CCAAAAATACAAATGAGAAAAGG + Intergenic
1093805421 12:23426790-23426812 AAGAAAGTATGGATGAGCAACGG - Intergenic
1094548953 12:31431603-31431625 CATAAAATACAGACCAGGAAGGG + Intronic
1095535564 12:43242343-43242365 CAGACAATAGAAAAGAGCAAAGG + Intergenic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1098091537 12:66907387-66907409 CATAAAATACATATGAGCAGAGG - Intergenic
1098239173 12:68448875-68448897 CAGAAAAGAGGGATGAGGAAGGG + Intergenic
1098677814 12:73313634-73313656 CAGAAAATACAAAAGAGCAGGGG - Intergenic
1100029991 12:90174992-90175014 AGGAAAATGCAGATAAGCAAAGG + Intergenic
1100932163 12:99621576-99621598 CAGAAAATGAAAAAGAGCAAGGG + Intronic
1101066044 12:101021686-101021708 AAGAAAATACACATTAGAAATGG - Intronic
1104074045 12:125373727-125373749 CAGAAAACACAGGTTAGAAAGGG - Intronic
1104093082 12:125532165-125532187 CAGAAATTATACATCAGCAAAGG - Intronic
1104281528 12:127382470-127382492 CAGAAATTATACATCAGCAAAGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1105571687 13:21609678-21609700 CAGCACATCCAGAGGAGCAAGGG + Intergenic
1105632346 13:22182860-22182882 GAGAATTTACAGATGAGCATGGG - Intergenic
1105796590 13:23860265-23860287 CAGTTAATCCAGATGAGAAAGGG + Intronic
1106822589 13:33482405-33482427 GACAAAATACTGATGGGCAACGG - Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107153538 13:37140211-37140233 CAGAAAACACAGAAGTGAAAGGG - Intergenic
1109077579 13:57857409-57857431 CAGAAAAGACACATTAGAAAGGG - Intergenic
1109401340 13:61833071-61833093 CATAAAATACACTTGAGGAAAGG - Intergenic
1109523786 13:63547267-63547289 CATAATATACAAATGAGCAGTGG - Intergenic
1110204313 13:72894824-72894846 AAGTAAATACAGATGATCCAGGG + Intronic
1110575819 13:77053770-77053792 AAGAAAATACAGAGGATGAATGG - Intronic
1111234226 13:85388152-85388174 CAGAAAATACATCTAAGTAAAGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112614713 13:100991832-100991854 CAGAAAACACAAAAGAGCAGGGG + Intergenic
1112883797 13:104143813-104143835 CAGAAAACACAGGTGATTAACGG + Intergenic
1113203288 13:107889877-107889899 CAGAAAATAAAGTTGTGTAAGGG + Intergenic
1113214331 13:108020429-108020451 CAGAAAACAGAAAAGAGCAAGGG + Intergenic
1113452555 13:110421809-110421831 CAAGAAATAAAGATGAGAAAGGG + Intronic
1114476180 14:22996679-22996701 CATAAAAGACAAATGAGCAAAGG + Intronic
1114791674 14:25666524-25666546 AAGGAAATACACATGAGAAAGGG - Intergenic
1115173838 14:30539320-30539342 AAAAAAATAAAAATGAGCAAAGG + Intergenic
1115849434 14:37577809-37577831 CAGAAAATAGAGATTGGGAATGG + Intergenic
1115891756 14:38038281-38038303 AAGAAAATACATACGATCAACGG + Intronic
1116691644 14:48114843-48114865 GATAAAATAGAGATTAGCAAAGG - Intergenic
1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG + Intergenic
1117761020 14:59028682-59028704 CAGAGAAAACAGATGACAAAGGG + Intergenic
1118872005 14:69750888-69750910 CAGAAAAGAGGGATGAGGAAGGG - Intronic
1119111078 14:71974737-71974759 CAGAAAATAATAAAGAGCAATGG - Intronic
1119136038 14:72221263-72221285 AAGAAAATTAGGATGAGCAATGG - Intronic
1119312468 14:73660471-73660493 CATAAAGTGCAGATGATCAAGGG - Intronic
1119356630 14:74012590-74012612 CAGGAAATATAAATGAGTAAAGG + Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119952899 14:78764304-78764326 TAGAGAAGACAGATGACCAAGGG + Intronic
1120582765 14:86273431-86273453 CAGAAAACACAAAAGAGAAAGGG - Intergenic
1120829299 14:88983983-88984005 CAGAGAATACAGATAACAAAGGG - Intergenic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121851760 14:97227839-97227861 CAGAAAATACAGCAGAGCCAAGG - Intergenic
1123538709 15:21264137-21264159 CAGAAAATGCAGCTCATCAAAGG - Intergenic
1123626672 15:22231881-22231903 CAGAACCGACAGATGAGCCAGGG + Intergenic
1124718639 15:32092561-32092583 CAGAAAATACGAATGAGGCATGG - Intronic
1124934595 15:34158309-34158331 AAGAAAATTCAGAAGAGAAATGG - Intronic
1125121310 15:36161955-36161977 CAGAGAAAACAGTTGAGCACAGG + Intergenic
1125126995 15:36236091-36236113 CAGAATTTACAGATAAGCAAAGG + Intergenic
1125448078 15:39779379-39779401 CAGAAAATACAGATAAGCAAGGG - Intronic
1125587147 15:40828914-40828936 CATAAACTGCAGATGAGCAAAGG + Intergenic
1125803661 15:42473481-42473503 CAGAAAATGTAGAGGTGCAAAGG - Intronic
1125913504 15:43463433-43463455 AAGAAATAACAGATGAACAAGGG + Intronic
1126238129 15:46409485-46409507 CAGAAAAAAGAGCAGAGCAATGG - Intergenic
1126661806 15:51039723-51039745 GAGAAAATATAGGTGAGTAAGGG - Intergenic
1126666404 15:51079179-51079201 CAGAAAATGCAAAAGTGCAAGGG - Intronic
1126724728 15:51621166-51621188 CATAAAACACAGATGACAAAAGG + Intronic
1126917793 15:53484735-53484757 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1126944412 15:53803062-53803084 GGGAATATACAGATAAGCAAGGG + Intergenic
1127453010 15:59134768-59134790 AAGAACATACAGAAGATCAAGGG - Exonic
1128353014 15:66904134-66904156 CAGACAAGACAGATGACAAAAGG + Intergenic
1128626715 15:69214737-69214759 AAGAAATTACAAATAAGCAAAGG - Intronic
1129146746 15:73655025-73655047 GAGAAAAAACAGATTAACAAGGG - Intergenic
1129417065 15:75390239-75390261 CATAAAGTACAGATGAGGAAAGG + Intronic
1130324335 15:82866980-82867002 CAGAACAAACAGGTGAGAAATGG + Intronic
1130687769 15:86053982-86054004 CACAAAAATCAGATGGGCAAAGG - Intergenic
1131246610 15:90799764-90799786 AACAAAAAACAGATTAGCAAGGG + Intronic
1133910697 16:10063556-10063578 CAGAAAATCCAGATTATCAATGG - Intronic
1134783406 16:16919177-16919199 TTGAGAATACAGATAAGCAAAGG - Intergenic
1134814010 16:17191108-17191130 CAGAAAAGAGGGATGAGGAAGGG + Intronic
1135177095 16:20239959-20239981 CAGGAAGTACAGAAGAGCTAAGG + Intergenic
1137657068 16:50169322-50169344 CAGAAAATACAGGGGAAAAAGGG - Intronic
1137740118 16:50761467-50761489 CAGAGAACAGAGATGAGCAGAGG - Intronic
1138388600 16:56653464-56653486 CAGAAAATAAAAATGAGAAATGG - Intronic
1138627213 16:58261879-58261901 CAGAAATATCAGATGATCAAAGG + Intronic
1139372722 16:66478885-66478907 CAGAGGGCACAGATGAGCAAAGG + Intronic
1139394299 16:66627979-66628001 CAAAAAAAACATGTGAGCAAAGG + Intronic
1139478897 16:67217393-67217415 CAGAAAAAGCAGCTGAGCAGAGG - Intronic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1142360388 16:89623490-89623512 CAGAAGGTCCAGATGAACAATGG + Intronic
1143485951 17:7254083-7254105 CAGAAAAAACAGCTCAGGAAAGG - Intronic
1143787687 17:9268390-9268412 TAGGAAATACACAAGAGCAAAGG + Intronic
1144074363 17:11703491-11703513 ATGATACTACAGATGAGCAATGG + Intronic
1144435887 17:15240337-15240359 AAGAAAATACTGATGAAGAAAGG + Intronic
1144820271 17:18068025-18068047 CACAAACTCCAGAGGAGCAAAGG + Exonic
1144852590 17:18251558-18251580 CAGAAAGAACAGCTGTGCAAAGG - Intronic
1145107668 17:20133123-20133145 AAGAATATACAGATTACCAATGG - Intronic
1145229430 17:21161877-21161899 CAGCAAACACAGAGGAGGAAGGG - Intronic
1146484470 17:33231847-33231869 CTCAAAATTGAGATGAGCAATGG + Intronic
1147452592 17:40515045-40515067 CATCAAATACAGATGAGTTAAGG + Intergenic
1148736730 17:49869334-49869356 CAGAAAATCCAGACCTGCAAAGG - Intergenic
1149971826 17:61226644-61226666 CAGAAAATACACATGAGTACTGG - Intronic
1150520075 17:65857172-65857194 CAGAAAAGAGGGATGAGGAAGGG - Intronic
1150585067 17:66510083-66510105 CAGAAAAGAGGGATGAGGAAGGG + Intronic
1150897196 17:69225907-69225929 CAAAAAATATAGATGATAAAGGG + Intronic
1151013531 17:70529464-70529486 CAGAAAATACTGAGCAGAAAGGG - Intergenic
1152144521 17:78560350-78560372 CGGAAAGTTCAGATGAGCAGAGG - Intronic
1152491688 17:80639153-80639175 GAGAAAATACATAATAGCAAAGG - Intronic
1153038529 18:788048-788070 CAGAATATAAATATGAGGAATGG - Intronic
1153394372 18:4601947-4601969 CTGAAAATACAGAAAAGTAAGGG - Intergenic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1154158599 18:11962931-11962953 CACAAAATGCAAATGAGGAAGGG - Intergenic
1154198596 18:12283806-12283828 GAGATAAAGCAGATGAGCAATGG + Intergenic
1155246901 18:23919560-23919582 CATAAAAGACACTTGAGCAAAGG + Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155402636 18:25456221-25456243 CAGCCAAGACAAATGAGCAATGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155779578 18:29813752-29813774 CAGAAAACAAAAAAGAGCAAGGG + Intergenic
1156153820 18:34277246-34277268 CAGACACTAGAGCTGAGCAAGGG + Intergenic
1156758586 18:40558828-40558850 CAGAAAATGCAGATGAGTGTAGG + Intergenic
1156987017 18:43360695-43360717 AAGAAGGTCCAGATGAGCAATGG + Intergenic
1157927457 18:51781817-51781839 CAGAAAAGAGGGATGAGGAAGGG + Intergenic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158234046 18:55293193-55293215 CAGAAAAAAAATATTAGCAAGGG + Intronic
1158283339 18:55851484-55851506 CAGAAAACACTCTTGAGCAAAGG + Intergenic
1158365447 18:56728962-56728984 CAGTAAATACACCTGAGCAAAGG - Intronic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1160234041 18:77071513-77071535 CAGAACAGAAAGATGAGGAAGGG + Intronic
1160405339 18:78641994-78642016 CAGAGAATATAGCAGAGCAAAGG + Intergenic
1161831330 19:6606727-6606749 CACAACATTCAGATCAGCAAGGG + Intergenic
1162370778 19:10277891-10277913 AAGAAAAAACAGAAGAGCACTGG + Intronic
1164856131 19:31525156-31525178 AAGAAATTACAAATAAGCAAGGG - Intergenic
1165241173 19:34468967-34468989 TAGAAAATACAGGTGAGCACAGG + Intronic
1166158727 19:40935840-40935862 CAGAAAAGAAGGATGAGGAAGGG + Intergenic
1166359235 19:42245691-42245713 CAGAAATTACTGGTGACCAAGGG + Intronic
1167336341 19:48888351-48888373 CAGAAAATGTGGATGGGCAAGGG - Intronic
925770446 2:7277228-7277250 CATAAAATACACATGAAGAATGG + Intergenic
925888781 2:8416421-8416443 GAGAAACTAGAGATGAGCAGGGG - Intergenic
926078640 2:9964807-9964829 CAGTAAATACAGATTTGCACAGG - Intronic
926537745 2:14134316-14134338 CAGAAAAAGCAGATGAGAAAGGG + Intergenic
927417239 2:22892113-22892135 CAGAAAATACTTAGGAACAAGGG + Intergenic
928706413 2:33954344-33954366 TATAGAATAGAGATGAGCAAAGG - Intergenic
929404981 2:41631235-41631257 CAGACACCACAAATGAGCAAAGG + Intergenic
929493733 2:42420958-42420980 AACAACATACAGTTGAGCAATGG - Intronic
930148887 2:48037668-48037690 CAGCTAATACAGATGATGAAAGG - Intergenic
930777942 2:55193462-55193484 CACAATTTACAAATGAGCAAAGG + Intronic
930977769 2:57484963-57484985 CAAAAACTTCAGATGAGCAGAGG - Intergenic
931048019 2:58379149-58379171 CAGAAACTACAGATAAGCGGGGG - Intergenic
932293340 2:70603392-70603414 GAGAAGATAAAGATGTGCAAAGG - Intergenic
932578606 2:72978036-72978058 AAGAAAATATAGATGAACACTGG - Intronic
935163386 2:100548582-100548604 CAGAAAAAAGGGATGAGGAAGGG - Intergenic
935476708 2:103531309-103531331 CAGGAAATACAGGGGAACAATGG - Intergenic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
935833887 2:107029088-107029110 AAGAAAATACATAAGACCAAGGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936639762 2:114298876-114298898 CAGAAAAGATAGATGACCCATGG + Intergenic
936704495 2:115056222-115056244 CAGAAAATATATATGAGTCAAGG + Intronic
936707756 2:115095717-115095739 AATTAAATACACATGAGCAATGG + Intronic
936712156 2:115143699-115143721 CAGATAATACAAATGACCTAAGG - Intronic
936846725 2:116843385-116843407 CAGAAAAAAAGGAGGAGCAAAGG + Intergenic
937017402 2:118618677-118618699 AAGAAAATCCGGATGAGAAATGG + Intergenic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
937609504 2:123842945-123842967 CAGAAAACAAAGAAGAGCATGGG + Intergenic
937668029 2:124509037-124509059 CAGAGAATGCAGATAATCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938463330 2:131511668-131511690 CAGAAGAGACAGAAGAGCAGAGG - Intergenic
939619350 2:144399263-144399285 CAGAAAGTACAGATGACAAGAGG + Exonic
939654175 2:144802155-144802177 CAGAAATCACAGATGAGCCAAGG + Intergenic
939683234 2:145164941-145164963 GATAAACTAAAGATGAGCAAAGG - Intergenic
940038994 2:149339754-149339776 CAGAGAATAAGGATGAGCAGGGG - Intronic
940371676 2:152908891-152908913 AAGAAAATTCAGATGACCTAGGG - Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
941185913 2:162321153-162321175 CAAAAAATATAGATGAAAAAAGG - Intronic
941208296 2:162602551-162602573 CAGAGGAAACAGATGTGCAAAGG - Intronic
941478917 2:165982157-165982179 CAGAAAAGGGAGATGAGCAAGGG + Intergenic
943110950 2:183605169-183605191 CAGAAAATGCAAATCAGCACAGG + Intergenic
943431523 2:187808795-187808817 AAGAAGTTACAGATAAGCAAGGG + Intergenic
943501703 2:188698394-188698416 CAGGACATACACATGGGCAAAGG - Intergenic
943793937 2:191968169-191968191 CAGATAACACAGCTGAGAAAAGG + Intronic
943985952 2:194618864-194618886 CATACAATACAGATGAGCAGAGG - Intergenic
944051687 2:195476998-195477020 CAGGAAATAGAGATGAGCTTGGG - Intergenic
945640822 2:212427405-212427427 CAGAATATACAGTAGAGAAAGGG - Intronic
945731706 2:213545539-213545561 CAGAAAATCTAGATGACCTAGGG - Intronic
945909490 2:215632222-215632244 CAGAAAAAACCCAGGAGCAAAGG - Intergenic
946600777 2:221357567-221357589 CAGAACAAATAGTTGAGCAATGG - Intergenic
947154610 2:227149420-227149442 CAGAAAAGAGAGATGAGGAAGGG - Intronic
1169690528 20:8325840-8325862 CAGAAAGTACAGAGGATGAAAGG + Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170937284 20:20821353-20821375 CAGACCATAAAGATGAGCCATGG + Intergenic
1172144462 20:32746537-32746559 CAGAAAATACAGAAAAGGAAAGG + Intergenic
1173003380 20:39121654-39121676 CAGAAGATGCAGATGAGGAGGGG + Intergenic
1173010271 20:39175867-39175889 CTTAAACTACAGCTGAGCAAAGG - Intergenic
1173078677 20:39845455-39845477 CAGAGGAAACAGATGTGCAAAGG + Intergenic
1173771171 20:45659780-45659802 CAGGACATAGGGATGAGCAAAGG - Intronic
1174167442 20:48595069-48595091 CAAAAATCACAGATGAGAAAGGG + Intergenic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175057567 20:56212034-56212056 CAAAAAAAACATGTGAGCAAAGG + Intergenic
1175150785 20:56932214-56932236 CAGAAAATTCAAATAAGCTATGG + Intergenic
1175407881 20:58746505-58746527 CAGAAATAAGAAATGAGCAAAGG + Intergenic
1175571129 20:60023277-60023299 CAGAAAATCCAAAAGAGCAATGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176525259 21:7861534-7861556 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1177120155 21:17128167-17128189 CAGTCAAAACATATGAGCAAGGG - Intergenic
1177287319 21:19069057-19069079 TAAAAAATAAAGATGATCAATGG + Intergenic
1177328602 21:19627706-19627728 CAGACAAGAGAGAGGAGCAAAGG - Intergenic
1177339145 21:19777065-19777087 CAGATAATAAAAATTAGCAATGG + Intergenic
1177530938 21:22356952-22356974 CAGAAAACACACATGATGAAAGG - Intergenic
1177757332 21:25362871-25362893 TACAAAATACAGGTGAGCACGGG - Intergenic
1177996629 21:28107793-28107815 CAGATGATACAGAAGAGAAAGGG + Intergenic
1178065647 21:28901887-28901909 CAGAGAATACTGAAGAGCTAGGG - Intergenic
1178659279 21:34491547-34491569 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1178799631 21:35780531-35780553 CAGAAAAAACAGACAAGAAATGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179830157 21:43991650-43991672 CGGAAAAGCCGGATGAGCAAAGG + Intergenic
1180907849 22:19427761-19427783 CAGAAAAAACTCAGGAGCAAAGG + Intronic
1182068834 22:27449024-27449046 CAGAAAATGCAGTTGAACCAAGG + Intergenic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
1184265132 22:43342654-43342676 GAGAAAAGACAGATGCGGAAGGG - Intronic
949521464 3:4858708-4858730 AAAAAAATAAATATGAGCAAGGG + Intronic
950724091 3:14905050-14905072 GAGAATTTACAGATAAGCAAGGG - Intronic
951269436 3:20607105-20607127 AAGAGAACACAGATAAGCAAAGG + Intergenic
951313477 3:21159364-21159386 AAGCAAATGCAGATCAGCAAAGG + Intergenic
951627237 3:24679193-24679215 CAGATAATAGAGATGAAAAATGG + Intergenic
951922549 3:27872354-27872376 CAGAAAAGAGGGATGAGGAATGG + Intergenic
952270344 3:31824956-31824978 CAGAAAGTTCTGCTGAGCAATGG + Intronic
952602309 3:35100226-35100248 CAGAAAATACAGAAAATCAGTGG + Intergenic
953578477 3:44132268-44132290 CAGCATTTACAGATGAGCAATGG - Intergenic
953597735 3:44334282-44334304 CAGAAGGTACAGAGGAGCATGGG - Intergenic
954963018 3:54582630-54582652 CAGAAAATCAACATGGGCAATGG - Intronic
955776296 3:62437434-62437456 CAGAAAATGCAGATTACCAAGGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956063482 3:65372485-65372507 CAGAATAGCCAGATGAGCACTGG + Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956319102 3:67975680-67975702 CAGAAAATTCACATGAAAAAAGG + Intergenic
957380520 3:79422558-79422580 CAGAAAATAAGAATGAGAAAGGG + Intronic
957761446 3:84562737-84562759 CAGATAATACAGACTAGGAAGGG + Intergenic
957920109 3:86735831-86735853 CAGAAAATAAAGAACATCAAGGG - Intergenic
958106776 3:89084529-89084551 CAGAAAGAACAGAAGAGCCAAGG + Intergenic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
958982855 3:100744468-100744490 CAGTAAATAAAAATGAGAAAAGG - Intronic
959226336 3:103591754-103591776 AAGAAGATAAAGATTAGCAAAGG - Intergenic
959540568 3:107532650-107532672 CAGAAAATACAGAAGACTACAGG + Intronic
959561740 3:107790125-107790147 CACCAAATACAGATGAGAAGAGG - Intronic
959729149 3:109581181-109581203 CAGAAAATACTGTAGAGGAAGGG - Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960325314 3:116288315-116288337 AAGAAAAGACAGATGAGAGAAGG + Intronic
962443029 3:135440212-135440234 TAGAAAATGCAGATAAGAAAAGG - Intergenic
963244846 3:143048211-143048233 CACAGAAAACAGATGATCAAGGG - Intronic
963492170 3:146015718-146015740 CAGAAACAAGAGAAGAGCAAAGG - Intergenic
964233543 3:154498419-154498441 CAGAAAAGAGGGATGAGAAAGGG + Intergenic
964664076 3:159152594-159152616 CAAAAAATACAGCAAAGCAAGGG - Intronic
966505950 3:180701921-180701943 CAGAAAATACAGCTCAACATTGG - Intronic
966858523 3:184213978-184214000 GAGAACATATAGGTGAGCAAGGG - Intronic
968423753 4:507014-507036 CAGATAATTTAAATGAGCAAGGG - Intronic
969958599 4:10918879-10918901 TAGAAAATCCAGATGACCGAGGG + Intergenic
970264193 4:14263200-14263222 TAGGAAATTAAGATGAGCAAAGG + Intergenic
971435137 4:26613419-26613441 CAGAAAAGAGAGATGAGGAAAGG + Intronic
971863386 4:32138067-32138089 CTGCAAATACAGATTAGCATTGG + Intergenic
971869760 4:32219502-32219524 CAGAAAATACTGATAATCTATGG + Intergenic
971923282 4:32971646-32971668 AGGAAAATACAGATTAGGAAGGG - Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972895751 4:43617797-43617819 CAGAAAACATAGAAGAACAAGGG + Intergenic
974327552 4:60434182-60434204 AAAAAAATACAAATGACCAATGG - Intergenic
975075747 4:70206947-70206969 CAGAAAATATAAATCAACAAAGG - Intergenic
975679973 4:76866958-76866980 CAGACAATCCAGATGAGGAAGGG + Intergenic
975801618 4:78065533-78065555 TAGAAAATGAAAATGAGCAAAGG + Intronic
975893953 4:79063507-79063529 CAGATAATTGAGATGTGCAATGG - Intergenic
976404597 4:84648898-84648920 CAGAAAATACACTTTAGAAAAGG - Exonic
977224219 4:94375372-94375394 CAGAAGAGACTGATGAGCAGTGG - Intergenic
977689574 4:99891740-99891762 TAGAAGAAACAGATGACCAAGGG + Intronic
978329405 4:107596454-107596476 CAGAAAATACATATGAACTAGGG + Intronic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
980198890 4:129627891-129627913 CACAAAAGACAGATTATCAAGGG - Intergenic
980692620 4:136315124-136315146 GAGAAAATATAGATCAGCCAAGG + Intergenic
980715081 4:136617281-136617303 GAGGAAAGTCAGATGAGCAAGGG - Intergenic
980734773 4:136870323-136870345 TATAAAATACAGATGATTAATGG + Intergenic
981008867 4:139903946-139903968 GTGAAAACACAGAAGAGCAAAGG + Intronic
981811988 4:148785985-148786007 GAGAAAACGGAGATGAGCAAAGG - Intergenic
982114774 4:152089199-152089221 CAAAAAAAACATATGTGCAAAGG + Intergenic
983116197 4:163819381-163819403 CACAGAATTCAGATGTGCAATGG - Intronic
983636707 4:169905242-169905264 CAGAAAATAAAGAGGTGCCATGG + Intergenic
984313055 4:178088629-178088651 TAGAAAATAAAGATGAGCACTGG - Intergenic
984398593 4:179231695-179231717 CAGACAATTCAGATTAGCTATGG + Intergenic
984876122 4:184369232-184369254 CAGATAAAAAAGATCAGCAAAGG - Intergenic
984968493 4:185164597-185164619 CAGAAAAGAGAGATGAGGAAGGG - Intronic
986428528 5:7658216-7658238 CAGAAACTTCAGTTGAGGAAAGG - Intronic
987306357 5:16641314-16641336 CAGAAAAGAAGGAAGAGCAAGGG + Intergenic
988468979 5:31519107-31519129 CAGAAAATAAAAATTAGAAATGG - Intronic
988497585 5:31758196-31758218 CACAAAATACAAATGAGTTAAGG - Intronic
988901958 5:35743216-35743238 TAGAAAATAAAGCTGAGGAAAGG + Intronic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989461677 5:41706791-41706813 CAGAAAACAAAAGTGAGCAAAGG - Intergenic
990062176 5:51664916-51664938 TAAAGATTACAGATGAGCAAGGG - Intergenic
990177370 5:53122805-53122827 CAGAAATAAAAGAGGAGCAATGG + Intergenic
990263638 5:54052589-54052611 GAGAGATTACAGATAAGCAAGGG + Intronic
991269188 5:64759154-64759176 CAGAAAATAGAAATGACCCAGGG - Intronic
992196395 5:74343618-74343640 CATAAAATACTGGTGAGAAATGG - Intergenic
992725215 5:79599935-79599957 CAAAAAAAACGGATGAGGAAGGG - Intergenic
993135989 5:83965152-83965174 GAGAAAATATAAATGATCAATGG - Intronic
993227632 5:85187656-85187678 CAGAAAGGAGAGATGAGGAAGGG + Intergenic
993820993 5:92616727-92616749 AAGGTAATAGAGATGAGCAAAGG - Intergenic
994893469 5:105669766-105669788 CAGAAAAGAGGGATGAGAAACGG - Intergenic
995030609 5:107476413-107476435 TTGAAAATACAGATGTGTAAAGG - Intronic
995030671 5:107477433-107477455 CAGAAAATACATATTGGCAAAGG + Intronic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995232175 5:109779471-109779493 CAGCAGATACAGATGAGCTCAGG - Intronic
995245018 5:109925264-109925286 CAGAAAATCAAGATGGGAAAAGG - Intergenic
995404918 5:111784171-111784193 AAGAAAATATAGCTAAGCAATGG + Intronic
995535490 5:113131603-113131625 CAGAAAAGAGAGGTGAGTAAAGG + Intronic
995694842 5:114867112-114867134 CAAACAATTCAGATGAGGAAGGG + Intergenic
995820566 5:116225856-116225878 CAAAATTTACACATGAGCAAGGG - Intronic
995876178 5:116792596-116792618 CATAAAAAACAGATAAGCAAAGG - Intergenic
996500124 5:124207484-124207506 GAGAAAAGACAGATGAGGTAGGG + Intergenic
996695647 5:126392060-126392082 CAGAAGATATAGTTTAGCAAAGG - Intronic
996768995 5:127065747-127065769 CAGAAAAGACTGTTGAGAAAAGG + Intronic
997760145 5:136438638-136438660 GGGAAGTTACAGATGAGCAAGGG - Intergenic
997767391 5:136518808-136518830 CAGAAAAGCCAGATGGGCAGAGG + Intergenic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
999046756 5:148477962-148477984 TAAAAAATAGAGATGGGCAAGGG - Intronic
999591316 5:153150051-153150073 CAGAAAATAAAAAAGAGCAGGGG + Intergenic
999940478 5:156537234-156537256 CACAAAACACAGATGTGCCAAGG - Intronic
1000169698 5:158690059-158690081 CAGAAAAAAGAAATGAGAAAAGG + Intergenic
1000362767 5:160463211-160463233 TAGAAAGCACAGATGAGAAAAGG + Intergenic
1000457500 5:161469883-161469905 GAGAAAATAGAGATGAAGAAAGG - Intronic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1002049108 5:176559662-176559684 CAGAATATAAAGTTGAGAAATGG - Intronic
1002545419 5:179939996-179940018 GAGAAAATTCAGATGAGCAGTGG - Intronic
1002668829 5:180848482-180848504 CATAAAACACAGATGAGGAAAGG - Exonic
1003983040 6:11407492-11407514 CAGAAAATACAGGTATGTAAAGG + Intergenic
1004030509 6:11864105-11864127 CAAAAAATCCAAATGAGCAAAGG - Intergenic
1004292196 6:14377700-14377722 GACAAAAGACAGATTAGCAAGGG - Intergenic
1005355125 6:24975416-24975438 CAGAAAATTCAGAAAAGCATGGG + Intronic
1006456005 6:34132320-34132342 CAGAGAATGCAGATGAGGACGGG - Intronic
1006610292 6:35290601-35290623 CACATAATTCAGAGGAGCAAGGG - Intronic
1006828942 6:36957294-36957316 CAGAAGGTACACATCAGCAAAGG - Intronic
1007330408 6:41102351-41102373 AATAAAATACAAATGTGCAAAGG - Intergenic
1008108443 6:47466035-47466057 CAAAAAAGACAAATGAGCCAAGG + Intergenic
1008182586 6:48350770-48350792 CAGAAAATACCATTCAGCAACGG - Intergenic
1008533638 6:52489166-52489188 AAGTAAATACAGAAAAGCAATGG + Intronic
1009332968 6:62447077-62447099 GAGAACATAGAGATTAGCAAAGG - Intergenic
1010149808 6:72718305-72718327 CAGAACATGCAGACCAGCAAAGG - Intronic
1010285324 6:74070524-74070546 CAGATAATACAGATGTGGATGGG - Intergenic
1010523591 6:76873263-76873285 CAAAAAATTCAAAAGAGCAATGG + Intergenic
1010744370 6:79544118-79544140 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1010934452 6:81844842-81844864 CATAAATTAAAGATAAGCAATGG - Intergenic
1011267011 6:85532603-85532625 CAGAAAATAAAGTTGAGCTCAGG - Intronic
1011352497 6:86437775-86437797 CAGAAAAGACAGAGAAGGAATGG - Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1012844006 6:104366987-104367009 CAGAAAAGACAGATGGCTAAAGG - Intergenic
1012884489 6:104830392-104830414 CAAAAAATGCAAATGAACAATGG + Intronic
1012940322 6:105408602-105408624 GAGAAAATAAAGATGAGAATGGG + Intergenic
1013937145 6:115610777-115610799 CAGGAAAAAGGGATGAGCAAGGG + Intergenic
1013944388 6:115704480-115704502 CAGAAAAGAGACATGAGGAAAGG - Intergenic
1013986889 6:116205135-116205157 CAGAAAAGAGGGATGAGGAAGGG - Intronic
1014042282 6:116842511-116842533 TGGAAAACACAGATGATCAAAGG + Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1014966164 6:127754803-127754825 CAATAAAAACAGATGAGCAAAGG + Intronic
1015114225 6:129629372-129629394 GAGAAAATCCAGAAGAGCAAAGG - Exonic
1015385151 6:132614016-132614038 CAGATAAGAAAGATCAGCAAAGG + Intergenic
1015725786 6:136297981-136298003 TAGAAAATACAGAAGAGCAAAGG - Intergenic
1016325931 6:142901038-142901060 CAGAATACGAAGATGAGCAACGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017731329 6:157319253-157319275 CATAATATTAAGATGAGCAAGGG + Intronic
1021345380 7:19521039-19521061 AAGGAAATAAAGATGGGCAAAGG + Intergenic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1021874792 7:25038316-25038338 CATAACAGATAGATGAGCAAAGG - Intergenic
1022226707 7:28371069-28371091 CAGCAAGTAAGGATGAGCAAAGG + Intronic
1022435834 7:30384120-30384142 CAGAAAAGAGGGATGAGGAAGGG - Intronic
1022766797 7:33421929-33421951 CAGAAAATACAGAAAAGGGAAGG + Intronic
1022816883 7:33922570-33922592 CAGAAAAGAGGGATGAGGAAGGG + Intronic
1023218417 7:37891698-37891720 CAGAAAAGAAGGATGAGGAAGGG - Intronic
1023226134 7:37971081-37971103 CAGCAAATACATATAAGCCAGGG + Intronic
1023497229 7:40810706-40810728 CAGAATAAACAGATGACCTATGG - Intronic
1023516272 7:41004963-41004985 CACAAAATACATATCTGCAATGG + Intergenic
1023706377 7:42945949-42945971 CAGAAAAGAGGGATGAGGAAGGG + Intronic
1024628395 7:51227895-51227917 CAGAAGATCCAGATAAGTAAGGG + Intronic
1026080239 7:67211666-67211688 GGGAATTTACAGATGAGCAAGGG - Intronic
1026696849 7:72602337-72602359 GGGAATTTACAGATGAGCAAGGG + Intronic
1028045461 7:86111945-86111967 CACAAAAAAAAGATGAGAAATGG - Intergenic
1028200832 7:87958773-87958795 GAGGAAATACAGATCACCAAAGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029510058 7:100988638-100988660 CAGGAAAAACAGAAGAGCTAAGG - Intronic
1030309822 7:108058020-108058042 TAGAACATACAGCTGTGCAAAGG + Intronic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1030593597 7:111510153-111510175 CAGAAAAAGCAGAGGAGAAAAGG + Intronic
1030738731 7:113083629-113083651 CAGAAAATCCAGGTTACCAAGGG - Exonic
1030907210 7:115200707-115200729 AAGCAAATACAAATGACCAATGG - Intergenic
1031319167 7:120300274-120300296 CAGAAAATACAGGTGTTCAGGGG + Intronic
1031335170 7:120520501-120520523 GAGGAAATACACATGAGAAATGG + Intronic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1032958322 7:137000137-137000159 AAGAAAATACTGATGAGTGAGGG - Intronic
1033786844 7:144742241-144742263 CAGAAATGACAGATGATCAATGG - Intronic
1034415234 7:150961094-150961116 CAGAGAAGACAGCTGAGCAGAGG - Intronic
1036274053 8:7334922-7334944 CAGCAAATACAGACAAGGAAGGG - Intergenic
1036274627 8:7339643-7339665 CAGCAAATACAGAAAAGGAAGGG - Intergenic
1036346725 8:7970703-7970725 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036347295 8:7975426-7975448 CAGCAAATACAGACAAGGAAGGG + Intergenic
1036703893 8:11032138-11032160 AAGAAAAACTAGATGAGCAAAGG - Intronic
1036842051 8:12131457-12131479 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036842610 8:12136212-12136234 CAGCAAATACAGACAAGCAAGGG + Intergenic
1036863883 8:12377707-12377729 CAGCAAATACAGAAAAGGAAGGG + Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1038473550 8:27845298-27845320 CAGAAATTAGAGATGAGCCTGGG + Intergenic
1038617455 8:29108019-29108041 CACATAATACAGATGAGTAGAGG + Intronic
1038626424 8:29197675-29197697 CAGAAAAGAAGGATGAGGAAGGG - Intronic
1038761994 8:30392801-30392823 TAGAAAATAGAGATGTGGAAAGG + Intronic
1039005952 8:33037285-33037307 CAGAAACTACAGAGGACCACGGG - Intergenic
1039053003 8:33512011-33512033 GAGAAAATGAAGATGAGAAAGGG - Exonic
1039930889 8:41987529-41987551 CAGAAACTACAGATGGGGATTGG + Exonic
1042047638 8:64671789-64671811 CAGAAAACCCAGATGATAAAAGG + Intronic
1042199234 8:66264346-66264368 CAGAAAAGAGAAATGAGAAAGGG + Intergenic
1042329311 8:67561242-67561264 CTGAGAATACAAATGAGGAACGG + Intronic
1042708762 8:71691493-71691515 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1042982196 8:74542126-74542148 CTGAAAAGAAAGAAGAGCAATGG + Intergenic
1043379556 8:79687995-79688017 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1043763318 8:84097401-84097423 CAGGAAAGAGAGATGAGCTAAGG - Intergenic
1044039644 8:87351323-87351345 CAGAAATTTCAAATGAGCCATGG + Intronic
1044353150 8:91190325-91190347 AATAACATACAGATGAGCAATGG + Intronic
1044720758 8:95143605-95143627 CAGTAAATAGAGAAGAACAAAGG + Intronic
1045067930 8:98468812-98468834 CAGAAAATAAAGATGAGAGCCGG + Intronic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045814043 8:106258748-106258770 CAAAAAATACAGAAGATAAATGG - Intergenic
1045901996 8:107293075-107293097 AAGGAAACAGAGATGAGCAAGGG - Intronic
1046344684 8:112907092-112907114 CAGAAAAGACAAATCAGAAAAGG + Intronic
1046967977 8:120188471-120188493 CAGAAAGTATAGAAGAGAAAGGG + Intronic
1048262797 8:132959921-132959943 CAGAAAAGAGTGATGAGGAAGGG + Intronic
1048414749 8:134213831-134213853 CAGAAAATACAGAGGACAGAGGG - Intergenic
1048694563 8:137011372-137011394 AAAAAAAGACAGTTGAGCAATGG + Intergenic
1049917440 9:332090-332112 TAGAAAATACACATAAGCAATGG + Intronic
1050863032 9:10460603-10460625 CCAAAAATACACATGAGGAAAGG + Intronic
1051370961 9:16358683-16358705 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1051498366 9:17750289-17750311 CCGAGAATACAGATGAGCAAAGG - Intronic
1051565533 9:18493714-18493736 CAGAAGCTGCAGATAAGCAAGGG - Intronic
1052109454 9:24562897-24562919 CAGAAAAGGCAGAGGAGGAAAGG + Intergenic
1054743632 9:68833193-68833215 AAGAAAATAAAGATAGGCAAAGG + Intronic
1055234647 9:74105986-74106008 CAGAAAGCTCAGATAAGCAAGGG - Intergenic
1055299549 9:74868839-74868861 CAGATAATAGAGACGATCAAAGG + Intronic
1055305366 9:74923827-74923849 CAAAAAATAGAGAAAAGCAAAGG - Intergenic
1056429823 9:86516308-86516330 CAGAAAATACAAAGTAGCAGAGG - Intergenic
1057314937 9:93961840-93961862 CAGAAAGTACAGATGTGACATGG - Intergenic
1057614169 9:96573320-96573342 AAAAAAATACAGATGAGAATCGG + Intronic
1058170967 9:101680789-101680811 CAGCAAATACATGTGAACAAAGG + Intronic
1059198249 9:112391255-112391277 CAGAAATTAAAGATGAGCCTGGG + Intronic
1059506652 9:114805438-114805460 TAGAAAATACAGATAAGGAGAGG - Intronic
1059533393 9:115058803-115058825 CACATAATAAAGATGAGCAACGG + Intronic
1060278584 9:122200506-122200528 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1060923637 9:127440196-127440218 AAGAAAATAAAGCTGCGCAAGGG + Intronic
1061364716 9:130166069-130166091 TAGAAAATACAGATGAGCCCGGG + Intergenic
1061712067 9:132495023-132495045 CAAAAAGTACAGTTAAGCAATGG - Intronic
1186680935 X:11873255-11873277 AAAAAAAAACAGATTAGCAAAGG + Intergenic
1186964437 X:14772420-14772442 CAGACAATCCAGATAAGGAAGGG - Intergenic
1187641093 X:21290972-21290994 CAGAAAATAGAAAAAAGCAAGGG - Intergenic
1190716842 X:53111744-53111766 CAGAAAAGAGGGATGAGGAAGGG - Intergenic
1191675617 X:63789306-63789328 CAGAAAGTACAGAAGCCCAAAGG + Intergenic
1192242429 X:69343842-69343864 AAAAAAACAAAGATGAGCAAAGG - Intergenic
1192347294 X:70321546-70321568 CAGAAAACACACAGGAGTAATGG - Intronic
1192718672 X:73669403-73669425 CAAACAATTCAGATGAGGAAGGG - Intronic
1194117560 X:89921818-89921840 CAGAAAATACGCAAGAACAATGG + Intergenic
1194321308 X:92449105-92449127 CAGAAAAGATAGATCAGCATAGG + Intronic
1194528656 X:95014833-95014855 GAGAATATACATATGAGTAATGG - Intergenic
1194654217 X:96551931-96551953 CAGAAAAGAAAGATGATAAAAGG - Intergenic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196397509 X:115280879-115280901 CAGAAAAGAGGGATGAGGAAGGG + Intergenic
1196510628 X:116507179-116507201 TAGATAATACAGAGAAGCAACGG - Intergenic
1196739910 X:119015650-119015672 CAAAAGATACAGATCAGCAATGG + Intronic
1196841998 X:119867616-119867638 GAGAAAACACAGATGATAAAAGG - Intergenic
1197397856 X:125949478-125949500 CCGAATATACAGATAATCAATGG - Intergenic
1197441704 X:126499181-126499203 GAGAGAGTACAGATAAGCAAGGG - Intergenic
1198913932 X:141645305-141645327 CAAAAAATAGAAATTAGCAAAGG - Intronic
1199133065 X:144217370-144217392 CACAAAACACAGATAAGCAATGG + Intergenic
1199488460 X:148373213-148373235 TAGAAAATCCAGATGAAGAATGG - Intergenic
1199532692 X:148868143-148868165 CAGAGAATGCTGATGAGGAAGGG - Intronic
1200470347 Y:3578977-3578999 CAGAAAATACGCAAGAACAATGG + Intergenic
1200770962 Y:7125137-7125159 CAGAAAACACAAAGCAGCAAAGG + Intergenic