ID: 1175880979

View in Genome Browser
Species Human (GRCh38)
Location 20:62258945-62258967
Sequence CCACCCCAGCACTGCCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175880974_1175880979 13 Left 1175880974 20:62258909-62258931 CCTTTTTAACCCATCCTCTCAAA 0: 1
1: 0
2: 2
3: 15
4: 252
Right 1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 181
1175880973_1175880979 26 Left 1175880973 20:62258896-62258918 CCATTTCAGGATTCCTTTTTAAC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 181
1175880975_1175880979 4 Left 1175880975 20:62258918-62258940 CCCATCCTCTCAAAATCACGATG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 181
1175880976_1175880979 3 Left 1175880976 20:62258919-62258941 CCATCCTCTCAAAATCACGATGT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 181
1175880977_1175880979 -1 Left 1175880977 20:62258923-62258945 CCTCTCAAAATCACGATGTCATC 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG 0: 1
1: 0
2: 0
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175880979 Original CRISPR CCACCCCAGCACTGCCTTTA TGG Intronic
900719696 1:4167309-4167331 CCACCCCGGCTCTGCCCTTGAGG + Intergenic
901079421 1:6575403-6575425 CCACCCCAGCACCTCCTGTCAGG + Intronic
903262627 1:22139613-22139635 CCTCCCCAGCACTTCCATTTGGG + Intronic
905352313 1:37356309-37356331 CCACCCCCGCCCTGCCCTCAAGG + Intergenic
905453333 1:38071089-38071111 CCAGACCAGCAGTGCCCTTAGGG - Intergenic
905540635 1:38757659-38757681 CCACCCAAGCACTGCCTTGTGGG - Intergenic
905822487 1:41004440-41004462 CCACCCCAGAGCTGGCTTTCTGG + Intronic
905894322 1:41535267-41535289 CCACCCCAGCGCTGGCTGGAAGG - Intronic
906284078 1:44574641-44574663 CTGCCCCTGCACTGCCATTAGGG + Intronic
913538287 1:119795239-119795261 CCACTCCAGCACTGCTTTTGAGG + Intronic
915097379 1:153472896-153472918 CCACCCCAGAACTGGCTCAATGG - Intergenic
916398512 1:164419089-164419111 CCACCCCAGCACAGCCTGCATGG + Intergenic
917521111 1:175749191-175749213 CCAGCTCAGCCCTGGCTTTAGGG - Intergenic
918258773 1:182774895-182774917 ACTCCCCAGCACTGCTTTTGGGG + Intergenic
922896188 1:229102367-229102389 CCACCCCTTCAATGCCATTATGG + Intergenic
923456355 1:234168832-234168854 CGACCCCAGCCCTGCCTATTGGG + Intronic
924903781 1:248430413-248430435 CCACCCCAACACTCTCTTCAGGG + Intergenic
924924090 1:248661591-248661613 CCACCCCAACACTCTCTTCAGGG - Intergenic
924946573 1:248850666-248850688 CCACCCCAGCACTCACTGCAGGG + Exonic
1066205279 10:33182962-33182984 ACATCACAACACTGCCTTTAAGG + Intronic
1066532395 10:36354983-36355005 CTACCCCAGTATGGCCTTTAGGG - Intergenic
1066546961 10:36510259-36510281 ACACCTCAGCACTACCTTCAGGG + Intergenic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076176642 10:128373268-128373290 CCACTCCAGAAATGTCTTTATGG - Intergenic
1077220098 11:1411945-1411967 CCACCGCAGGACTGCTGTTAAGG - Intronic
1077370910 11:2181196-2181218 CCACCCCAGCATGGCCTTGGGGG + Intergenic
1077735582 11:4787068-4787090 CCTCCACAGCTCTGGCTTTATGG + Intronic
1080872493 11:36249286-36249308 CCAGCACACCACTGCCTTTTAGG - Intergenic
1082626852 11:55496869-55496891 CCACCCAAACATTGCCTTTTTGG + Intergenic
1084276560 11:68054291-68054313 CCAGCCCAGCCCTGCCTCTCAGG + Intronic
1084946017 11:72638950-72638972 CCACCCCAACACCCCCTTCAAGG + Intronic
1084949107 11:72654928-72654950 CCACCCGAGACCTGCCTCTAGGG + Intronic
1085509851 11:77082688-77082710 CCAGCCGAGCTCTCCCTTTATGG + Intronic
1087828979 11:102798603-102798625 CTCCCCCAGCACTCACTTTACGG + Intergenic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090049312 11:123363315-123363337 CCACCCCAGCACTGGTTGTGTGG - Intergenic
1090251780 11:125256548-125256570 CAACCCCAGCACTGGCTTGGTGG - Intronic
1092348861 12:7739479-7739501 CCACCCCAGAAATGCCTCTATGG - Intronic
1092950483 12:13498939-13498961 CCACCCCAGCACAGGCTCAAAGG - Intergenic
1101148445 12:101863534-101863556 CCACCCAAACGCTGCCTTTTTGG - Intergenic
1102422811 12:112817393-112817415 ACACCCCAGCTCAGCCTTCAAGG + Intronic
1102971863 12:117174654-117174676 CCACCCCAGCTTGGCCTTCAAGG - Exonic
1103062975 12:117873806-117873828 ACACACCACCCCTGCCTTTAAGG + Intronic
1104748590 12:131224543-131224565 CTACCCTGGCCCTGCCTTTACGG - Intergenic
1107097064 13:36548417-36548439 CCACCGCAGCACTTCCTATCAGG + Intergenic
1108302625 13:49094113-49094135 CCACCCCACCTCTGCCATTTAGG - Intronic
1110488551 13:76074648-76074670 CCCTCTTAGCACTGCCTTTATGG - Intergenic
1111731541 13:92083330-92083352 CCACTCCCCCACTGCCTTTTTGG - Intronic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1113041539 13:106108458-106108480 CCACCCCAGCGCTTCTTGTAGGG + Intergenic
1113932265 13:113974644-113974666 GCACCCCACCACTGCCTGCAGGG - Intergenic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1117520749 14:56549193-56549215 TAGCACCAGCACTGCCTTTAAGG + Intronic
1118819035 14:69333163-69333185 CCACCGCAGCTCTGACCTTATGG - Exonic
1119732692 14:76961139-76961161 GCACCCCAGGAGTGCCTGTAGGG + Intergenic
1122343642 14:101044865-101044887 CATCCCCAGCGCTGCCTTCATGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123510399 15:20992928-20992950 CCATCCCAGTGCTCCCTTTATGG + Intergenic
1123567614 15:21566677-21566699 CCATCCCAGTGCTCCCTTTATGG + Intergenic
1125514102 15:40308291-40308313 CCACCCCACCCCTGCCTCTACGG - Intergenic
1126915699 15:53463876-53463898 CATCCCCAGCACTGTATTTATGG - Intergenic
1126946058 15:53821857-53821879 CCACCCCACCACCACCTTTCCGG + Intergenic
1127659769 15:61089613-61089635 CTACACCAGGACTGCCTTTCTGG - Intronic
1127836954 15:62797739-62797761 CCACACCAGCTCTCCCTTCAGGG - Intronic
1128390041 15:67176536-67176558 CCTCCCCACCTCTTCCTTTACGG + Intronic
1131171530 15:90182278-90182300 CCACCCCAGCACTGTTTGAAAGG + Intronic
1131389051 15:92032474-92032496 CCACCCCTGCACTGACTCTATGG - Intronic
1132366881 15:101264292-101264314 CCAGCCCAGGCCTGGCTTTAAGG + Intergenic
1202975977 15_KI270727v1_random:293772-293794 CCATCCCAGTGCTCCCTTTATGG + Intergenic
1134007513 16:10828023-10828045 CCTCCCCAGCCCTGCCTCCATGG - Intergenic
1136366837 16:29812879-29812901 CCAGCCTTGCACTGCCTCTAGGG - Intronic
1137728453 16:50672779-50672801 CCACCCCACCAGTGTCTTTGTGG - Exonic
1138230096 16:55330456-55330478 CCACCCCAGCTCTGCGTGCAAGG - Exonic
1144642269 17:16944097-16944119 CCACCCCAGATCTGCTTTGAAGG - Intronic
1148674734 17:49438733-49438755 CCACCCCAGCCCTGCTCTTTGGG - Intronic
1150030585 17:61730413-61730435 CAATCCCACCACTGCCCTTAAGG + Intronic
1152959303 18:68964-68986 CCACACCTGCAGTGACTTTAAGG - Intronic
1154293537 18:13130969-13130991 CCACCCTGGCCCTGTCTTTATGG + Intergenic
1155457357 18:26032409-26032431 CCACCCCAGCAGAGGCCTTATGG - Exonic
1156816530 18:41317863-41317885 CCACCCCAACTATGCCTTTTTGG + Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157496067 18:48158418-48158440 CTAGCCCAGCCCTGCCTCTATGG + Intronic
1157582351 18:48781028-48781050 CCCCCCCATCCCTGCCTTCACGG + Intronic
1158685696 18:59612355-59612377 CCACCACAACACTGCCTGGAGGG - Intronic
1160623779 18:80189057-80189079 CCACCCCAGATCTGGCTTCATGG + Intronic
1161479110 19:4501851-4501873 CCGCCCCTGCCCTGCCTGTAGGG - Intronic
1161842877 19:6693440-6693462 ACAACCCAGCTCTGCCTTTGCGG - Exonic
1163026089 19:14513250-14513272 TCACCCCTGCAATGTCTTTAGGG + Intergenic
1163169006 19:15517807-15517829 CAACCCCAGCTCTGCCCTGATGG - Intronic
1163300244 19:16440985-16441007 CCACCCCATCACTGGCCTTGCGG + Intronic
1163663228 19:18590741-18590763 CTACCCGGGCACTGCCTTTCTGG + Intronic
1165837778 19:38770145-38770167 CCACCCCAACCCCGCCATTAAGG + Intergenic
1165841787 19:38792552-38792574 CCACCCCAACCCCGCCATTAAGG - Intergenic
1167745878 19:51351620-51351642 CCACCCAGGCCCTGCCTTTTTGG + Intronic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
926695021 2:15765090-15765112 CCTCCCCGGAACTGCCTGTAAGG - Intergenic
929661250 2:43786947-43786969 TTGCCCCAGCAGTGCCTTTAGGG + Intronic
932053275 2:68419640-68419662 CCACCCCAGCACGGACTCTCAGG - Intergenic
932219170 2:69986933-69986955 CCACCCCAGCCTTGCCTTGTGGG + Intergenic
933261315 2:80134689-80134711 CCACCCCTGTTCTGCCTTTCCGG + Intronic
935017605 2:99198849-99198871 CAACCCAAACACTACCTTTAAGG + Intronic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936075504 2:109399042-109399064 CCGCCCCAGAACTGCCTTTTGGG + Intronic
936535304 2:113306491-113306513 CCATCCCACCTCTGCTTTTATGG - Intergenic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
938240470 2:129739041-129739063 CCTCCCCTGCACAGCCTTCAGGG - Intergenic
940128837 2:150358560-150358582 CTGCCCCTGCACTGCCTTTCTGG - Intergenic
943107274 2:183561106-183561128 TCCCCTCAGCACTGCTTTTATGG + Intergenic
947716136 2:232339744-232339766 CCTGCCCAGCAGTGCCTTTTGGG + Intronic
948554255 2:238796394-238796416 CCTGCCCAGCACTGCCTGTGTGG + Intergenic
1169211281 20:3767534-3767556 CCACCCCAGCCCTGCCATCACGG + Intronic
1169444435 20:5659642-5659664 CCACCCCAGCGCAGGCTTTGAGG - Intergenic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1175125552 20:56748792-56748814 CCTCCCCAGCACTCACTTCAAGG - Intergenic
1175166629 20:57048742-57048764 CCACCCCAGCTGTGCCTGTCTGG - Intergenic
1175222074 20:57422876-57422898 CCACCCCAGCATAAACTTTATGG - Intergenic
1175301644 20:57947332-57947354 CCACCCCACCCCTGCCATGAAGG - Intergenic
1175595344 20:60226768-60226790 CAACCCCAGCACGGCCTTCCCGG + Intergenic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1176042412 20:63072452-63072474 CGTCCCCAGCACTGCCCTTGCGG - Intergenic
1179885693 21:44313387-44313409 CCAGCCCAGGACTTCCTTTGGGG - Intronic
1180134483 21:45853334-45853356 TAACGCCAGCCCTGCCTTTAAGG - Intronic
1181882747 22:25994058-25994080 CCAGCCCAGGACTGCATTAAGGG - Intronic
1183243717 22:36677426-36677448 CCACCACTGCACTGCCTGGATGG + Intronic
1183303344 22:37069331-37069353 CCACCCCAGCATGGCCTCCACGG - Exonic
1183638239 22:39077623-39077645 CCACCCCAGCCATGACTTTCAGG - Intronic
1183675043 22:39294542-39294564 ACACCCCTGCACTGCCTTCTGGG + Intergenic
1184681986 22:46077265-46077287 ACACCCCAGCGATGCCTTGAAGG + Intronic
1185220626 22:49627537-49627559 GCACCCCTGCCCTGCCTTTGTGG - Intronic
950106769 3:10393523-10393545 CCATCCCAGCTCTGCCTTCCTGG - Intronic
950441727 3:13014593-13014615 CCACCCCAGCCCTGGCTCTTGGG - Intronic
951925864 3:27908236-27908258 CCAGCCCACTACTGCCTTCAGGG - Intergenic
952658558 3:35817360-35817382 CCACACTAACACTGCTTTTACGG - Intergenic
954383204 3:50230492-50230514 CCACCCCGAAACTGCCTTTGGGG + Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954798750 3:53175022-53175044 CCACCCCAGGACTGCATGGAGGG - Intronic
961640733 3:128363420-128363442 CACCCCCAGCCCTGCCTATAAGG - Intronic
962316660 3:134363640-134363662 GCCCCCCAGCACTGCCCTTCTGG - Intronic
962335186 3:134523474-134523496 CAACCCCAGCAATGCCATTCTGG - Intronic
962824737 3:139089816-139089838 CCACCCCAACAAAGCATTTAAGG + Intronic
964632273 3:158824411-158824433 CAACTCAATCACTGCCTTTAAGG - Intronic
966757927 3:183388737-183388759 CCACCCCAGCATTGCCTCCTGGG - Intronic
969105597 4:4804995-4805017 CCACAGCAGCACTGCCTCTGGGG + Intergenic
977372058 4:96150092-96150114 CCACATCAGCAGTTCCTTTATGG - Intergenic
981566879 4:146111208-146111230 CCACCCCAGCTCTGACTTAGCGG - Intergenic
988340020 5:29959437-29959459 CCACCCCAGCACTGGCATCATGG + Intergenic
993119015 5:83752920-83752942 CCACCACAGCACAGCTTTTATGG + Intergenic
994509333 5:100684155-100684177 CCACCACAGGACTGGCTATAAGG + Intergenic
995376868 5:111483943-111483965 CAACCCCAGCTTTGCTTTTAGGG - Intronic
996756383 5:126939984-126940006 GCACTTCAGCACTGCCCTTAGGG + Intronic
997243770 5:132328629-132328651 ACACCCCAGCACAGCCCTGAAGG - Intronic
998136028 5:139675105-139675127 AGACCCCAGCACTGCCTTCCAGG - Intronic
999124390 5:149236223-149236245 CCACATCAGCACTGCAATTAGGG - Intronic
1001560409 5:172665471-172665493 CCACACCTGCACTGCCTGTCAGG - Intronic
1002282134 5:178137304-178137326 CCACTCAAGGACGGCCTTTATGG + Intronic
1006503791 6:34475174-34475196 CCACCCAAACCCTGCCTTCATGG - Intronic
1006921768 6:37632287-37632309 CCAACCAAACACTGCCTTTGTGG - Exonic
1009751183 6:67881079-67881101 CAACCCCACCACTTCCTTTTCGG - Intergenic
1017025947 6:150180717-150180739 CCACCCCAGCCATGCTCTTAGGG - Intronic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1019530361 7:1500061-1500083 CCACCCCAGCTTTGCCTCTGGGG - Intronic
1020096970 7:5374690-5374712 CACCCCCAGCGCTGCCTTTTGGG - Intronic
1024670519 7:51589805-51589827 CACCCCCAGCCCCGCCTTTATGG + Intergenic
1026555427 7:71404657-71404679 CCACCCCAGCCTTGCCACTATGG - Intronic
1026976759 7:74503409-74503431 CCATCCCAGCTCTGCCTTTTGGG + Intronic
1028989173 7:97031928-97031950 CCACCCGAGGACTGTCTTTTAGG + Intergenic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1031020708 7:116624874-116624896 CCTCCCCAACACTGCCTTTCAGG - Intergenic
1033211171 7:139461289-139461311 CCACCCCAACACTGCTGCTATGG - Intronic
1034410410 7:150938437-150938459 GCGCCTCAGGACTGCCTTTAAGG + Intergenic
1034925446 7:155117900-155117922 TCTCCCCAGCTCTGGCTTTATGG - Intergenic
1036240916 8:7080375-7080397 CCACCTCAGCACAGACCTTACGG - Intergenic
1037325730 8:17688240-17688262 CCACCACAGCAGTGCCCTCATGG - Intronic
1039842951 8:41306849-41306871 CCATCCCATCACAGCCTTTTGGG + Intronic
1042582610 8:70297627-70297649 CCAGCCAAGGACAGCCTTTATGG + Intronic
1043516162 8:80996754-80996776 ACCCCCAAGCACTGCATTTAAGG - Intronic
1046697897 8:117362504-117362526 CCACCCCACAACTCCCTTTCTGG - Intergenic
1047780740 8:128109108-128109130 CCAGCCCAGCACTGGCTCGAGGG - Intergenic
1049906329 9:220475-220497 CCATTCCATCACTACCTTTATGG - Intronic
1053120825 9:35546594-35546616 CCTCCACAGCACTGCCTGTCTGG - Exonic
1057604496 9:96489389-96489411 CCACCTCAGAACCGCCCTTAGGG + Intronic
1058620584 9:106878790-106878812 CCACAGCAGCACTGACTATATGG - Intronic
1058653185 9:107196007-107196029 CCACCTCAGCACAGACTATATGG + Intergenic
1059950245 9:119454784-119454806 CCACCCCACCATTCTCTTTACGG - Intergenic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1061483537 9:130908925-130908947 CCACCCCAACCCTGCCTTTGGGG + Intronic
1062091561 9:134681153-134681175 CCACCCCAGCCCTCCCTGCAAGG - Intronic
1062738818 9:138154917-138154939 CCACACCTGCAGTGACTTTAGGG + Intergenic
1187301819 X:18058272-18058294 CCACCCCAGCACTCAGTTGATGG - Intergenic
1188985124 X:36762228-36762250 CCACCCAGGCACTGCCTATCAGG + Intergenic
1193095780 X:77547281-77547303 CCACCCCAACACTGCCAGCAAGG + Intronic
1197437868 X:126455246-126455268 CCAACCCAGCACTGGCTGCATGG + Intergenic
1197523863 X:127536914-127536936 CCACCTCAGCTCTTCCTTTTTGG - Intergenic
1200083884 X:153593346-153593368 CCACCCCAGCCCTGACTGGAAGG + Intronic
1200139595 X:153892760-153892782 CCACCCCTGAACTGCTATTATGG + Intronic