ID: 1175881504

View in Genome Browser
Species Human (GRCh38)
Location 20:62262096-62262118
Sequence AGTTTTAGGCAGAGGGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175881504_1175881512 1 Left 1175881504 20:62262096-62262118 CCCGTCACCCTCTGCCTAAAACT 0: 1
1: 0
2: 1
3: 25
4: 128
Right 1175881512 20:62262120-62262142 AGGCAGGATGACCACATGGCCGG 0: 1
1: 1
2: 2
3: 39
4: 288
1175881504_1175881511 -3 Left 1175881504 20:62262096-62262118 CCCGTCACCCTCTGCCTAAAACT 0: 1
1: 0
2: 1
3: 25
4: 128
Right 1175881511 20:62262116-62262138 ACTCAGGCAGGATGACCACATGG 0: 1
1: 1
2: 1
3: 25
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175881504 Original CRISPR AGTTTTAGGCAGAGGGTGAC GGG (reversed) Intronic
903556587 1:24198083-24198105 ATTCTTAGGCAGATGGAGACAGG - Intergenic
904893047 1:33793613-33793635 AGTTTTAAATAGTGGGTGACAGG + Intronic
905867337 1:41383140-41383162 AGTTTTCCGCAGAGGGTTGCTGG - Exonic
910496281 1:87832280-87832302 AGTTTCAGACTCAGGGTGACTGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
915349891 1:155217735-155217757 AATTCTGGGCAGGGGGTGACAGG + Intergenic
915353233 1:155239646-155239668 AATTTTGGGCAGGGGGTGACAGG + Exonic
917340718 1:173974781-173974803 ATTTATGAGCAGAGGGTGACAGG + Intronic
922820242 1:228479595-228479617 AGCTTTAGGTTGCGGGTGACAGG - Intergenic
923698242 1:236275882-236275904 AGTTTTAAGCAAAGGGTGACAGG + Intronic
1063937003 10:11088620-11088642 TGTCTTAGGCAGAGGGAGCCAGG + Intronic
1067281353 10:44875695-44875717 AGCTTAAGGCTGAGGCTGACAGG + Intergenic
1068065099 10:52120756-52120778 AGTTTCAGGCACAGACTGACAGG - Intronic
1068930211 10:62581775-62581797 AGTTTGAGGCAGAGAATGAGAGG - Intronic
1070479964 10:76872446-76872468 AGTTTTAAGCAAAGAGTGATGGG - Intronic
1071301386 10:84258413-84258435 AGTTGTAGGTGGAGGGTGACCGG + Intronic
1071985065 10:91042188-91042210 GATTTTAGGCAGAGGGGGAGGGG - Intergenic
1074584509 10:114754270-114754292 AGATTTATGCAAAGGGTGAAGGG - Intergenic
1077969346 11:7171586-7171608 ACTACTAGGCAGATGGTGACTGG - Intergenic
1078318491 11:10311709-10311731 TGTTTGTGGCAGAGGGTTACTGG - Intronic
1078778194 11:14412528-14412550 AGTTTTGGCCAAAGGGTGATAGG - Intergenic
1079875157 11:25846983-25847005 AATTTTAGGGCAAGGGTGACAGG - Intergenic
1081709460 11:45207640-45207662 AGTTTTATGGAGAAGGAGACTGG + Intronic
1081822407 11:46012295-46012317 AGAATTAAGCAGATGGTGACAGG - Intronic
1084095087 11:66906036-66906058 AGTTTCAGGCAGAGGTGGGCGGG + Intronic
1085414757 11:76312603-76312625 AGTTTTAAGCAGAGAGAGACAGG + Intergenic
1091873206 12:3912267-3912289 AGGTTTAGCTAGAGGGTGACAGG - Intergenic
1093791254 12:23253205-23253227 AGTTTAAGGCAGAGCCAGACAGG + Intergenic
1095247205 12:39936811-39936833 AGTTTTAGGCATACTGAGACTGG + Intronic
1096194025 12:49637430-49637452 AGTTATAGGGAGAGTGAGACAGG - Exonic
1099684653 12:85869205-85869227 TGTTTTAAGCAGAGAATGACAGG + Intergenic
1100267494 12:92991411-92991433 AGTTTTCAGTAGAGGGGGACAGG + Intergenic
1101995217 12:109520584-109520606 GGTTTTAGGCAAAGAGTAACAGG - Intronic
1110654783 13:77985217-77985239 GATTTTAGGCAGAGAGTGATGGG - Intergenic
1111236119 13:85410588-85410610 TGTTTTAGTCAGAGGGTGTTGGG - Intergenic
1112802580 13:103129152-103129174 AGTTTTAGGCAAAGAGTTAATGG - Intergenic
1117135992 14:52734564-52734586 AGTTTTAGGAGGACTGTGACAGG + Intronic
1117639798 14:57786033-57786055 ATTTCCAGGCAGAGGGTGAGGGG - Intronic
1118124696 14:62888790-62888812 ATTTTTAGGAAGAGGGATACAGG - Intronic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1123491200 15:20783918-20783940 AGCTTTAGACAGAGGCTGGCAGG - Intergenic
1123547702 15:21353009-21353031 AGCTTTAGACAGAGGCTGGCAGG - Intergenic
1127362891 15:58260562-58260584 AGTTTTAGGAAGATGGGGACTGG - Intronic
1129448018 15:75632429-75632451 AGGTACAGGCAGAGGGTGACTGG + Intergenic
1202956032 15_KI270727v1_random:80239-80261 AGCTTTAGACAGAGGCTGGCAGG - Intergenic
1133609297 16:7418071-7418093 AGGGTTGGGCAGAGAGTGACAGG - Intronic
1135110955 16:19690523-19690545 AGGTTTGAGGAGAGGGTGACAGG + Intronic
1135241912 16:20814781-20814803 AGTTCCAGGCAGACGGTGAATGG + Intronic
1137457965 16:48632642-48632664 ACTTTTAGGCAGAAGCAGACAGG - Intergenic
1137867554 16:51916429-51916451 AGATAAAGTCAGAGGGTGACCGG - Intergenic
1138504198 16:57469397-57469419 AGATTAAGGCAGAGGGTAACAGG - Intronic
1143050788 17:4124019-4124041 AGTTTGATGCTGAGGGTGATGGG - Exonic
1145887687 17:28394152-28394174 AATTTTAAGTAGGGGGTGACAGG + Intronic
1145899708 17:28482602-28482624 AGTTTTAAGCAGAGAGAGAGTGG - Intronic
1149954409 17:61032409-61032431 AGTTTTGGGAAGATGGTGGCTGG - Intronic
1150769196 17:68027095-68027117 AGATTGAGGCAGAGGATCACTGG - Intergenic
1153107727 18:1547253-1547275 AGTTTACAGCAGAGGGTAACTGG - Intergenic
1154106142 18:11524884-11524906 AGTTTATGGCAGAGGGTCAAAGG - Intergenic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155938589 18:31779987-31780009 AGTTTTAGACATTGGGTAACAGG - Intergenic
1156762456 18:40609699-40609721 AGTGTTTTGAAGAGGGTGACAGG - Intergenic
1157098389 18:44708062-44708084 GGTGTTTGGCAGAGGGTGAGGGG + Intronic
1157181046 18:45498436-45498458 AGTTTTGTGCCCAGGGTGACAGG + Intronic
1158039932 18:53080839-53080861 AGCTTAAGGGAGAGTGTGACAGG + Intronic
1158157104 18:54438350-54438372 AGTTTTAGACAGAGGGTCTAAGG - Intergenic
1163666294 19:18605619-18605641 AGTTTGAGGGCGAGGGTGACGGG + Intronic
1165247221 19:34504676-34504698 AGTGTGGGCCAGAGGGTGACTGG + Exonic
1165406116 19:35632467-35632489 AGTGTTAGGCAAGGGGTGAGTGG - Intronic
1166641513 19:44498598-44498620 AGTTTTAGACAGAGGGTGCTGGG - Intronic
1167566602 19:50261204-50261226 AGTTATAGGAAGGGGGTGATGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
932167203 2:69519158-69519180 AGTTTGCGGCAGAGGCTGGCTGG + Exonic
932931335 2:76043153-76043175 ACTTGTAGGCAGATGGTGATGGG + Intergenic
933998504 2:87687289-87687311 AGTTTATGGCAGAGGGGTACAGG - Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
936295345 2:111263584-111263606 AGTTTATGGCAGAGGGGTACAGG + Intergenic
939653584 2:144794296-144794318 AGATTTAGGCATAGGGTGAAAGG - Intergenic
942324537 2:174764888-174764910 AGTGTTAGGCTGAGGGTGCCGGG + Intergenic
945435304 2:209810697-209810719 AGTGTGGGGCAGAGGGTAACGGG + Intronic
947259570 2:228205014-228205036 AGTATTAGGGAGGGAGTGACCGG + Intergenic
1169479163 20:5962047-5962069 AGTTGTAGTCAGATGGTGGCTGG + Intronic
1169509969 20:6252907-6252929 AGCTTTAGTGAGGGGGTGACTGG + Intergenic
1169970242 20:11261874-11261896 AGTTTTAGCCAGAGGGAAACGGG + Intergenic
1171131561 20:22658369-22658391 AGTTTGAGCCAGAGGTTGAAGGG - Intergenic
1172326735 20:34041646-34041668 ATTTTTAGGCACAGGGTGATAGG + Intronic
1174063833 20:47850695-47850717 AGGTTGAGGCACAGGGTGGCAGG + Intergenic
1175881504 20:62262096-62262118 AGTTTTAGGCAGAGGGTGACGGG - Intronic
1181702024 22:24626872-24626894 AGTGATAGGCAGAGAGTGAATGG - Intronic
949691624 3:6646688-6646710 TTTTTTAGGGAGAGGGAGACAGG - Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
954293105 3:49660136-49660158 AATGTGAGGCAGAGGGTGGCAGG + Intronic
961488521 3:127234288-127234310 AGTAATAGGGAGAGGGTGACAGG + Intergenic
968123886 3:196144412-196144434 AGCCTGGGGCAGAGGGTGACAGG - Intergenic
974622209 4:64372016-64372038 AGTTTTGGTCAGAGTGTCACTGG + Intronic
975135420 4:70869662-70869684 GGCTTTAGGATGAGGGTGACAGG + Intergenic
976276152 4:83280678-83280700 AGTTTTAGGAGGAGGGAGAGAGG + Intronic
977351950 4:95899437-95899459 ATTTTTAGGAAGAGGGTGATGGG + Intergenic
983071645 4:163274637-163274659 AGGTTTAGGGAAAGGGTCACTGG + Intergenic
983643183 4:169962875-169962897 AATTTCAGGCAGATGGTGATGGG - Intergenic
987553822 5:19418849-19418871 ATTTTTAGTTAGAAGGTGACAGG - Intergenic
989173764 5:38499935-38499957 AGTTGTAGGCAGAGGAAGAGAGG - Intronic
992112403 5:73508547-73508569 ATTTTTAGGCTGATGGTGAGGGG - Intergenic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
1000365420 5:160486223-160486245 ACTTTTAGGCAGAAGGTTAGAGG + Intergenic
1001325130 5:170718572-170718594 TGTTTGACGCAGAGGCTGACAGG + Intronic
1006452746 6:34114576-34114598 AGGGTTGGGCAGAGGGTGAGTGG - Intronic
1006861962 6:37177754-37177776 AGTTTTAGGGGGAGGGTGAAAGG + Intergenic
1007376732 6:41462074-41462096 AGTCTTTGGGAGAGGGTGTCAGG - Intergenic
1007869135 6:45012956-45012978 AGTTTTAGTCAGGGGGTGTTTGG + Intronic
1008090987 6:47293715-47293737 AGTTTTAAGCAGAGGATGAAAGG - Intronic
1008936369 6:56996956-56996978 AGTTTTAAGCACAGGAGGACAGG - Intronic
1010839581 6:80632885-80632907 ACTTTTAGGCTGAGGGTTACAGG - Intergenic
1011748608 6:90433194-90433216 AGTTTGAGGGAGAGGGTAATAGG + Intergenic
1013969368 6:115998315-115998337 AGTTTTAGGCAGAAAGTAATTGG - Intronic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1018115416 6:160578991-160579013 AGTATTTGGCAGAAGGTGAAAGG - Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1021691674 7:23236198-23236220 TCTTGTAGGCAGAGGGTCACAGG - Intronic
1023047227 7:36220743-36220765 TGTTATGGGCAGAGGGTGAAAGG - Intronic
1023760477 7:43461192-43461214 AGTTGCAGTCAGAGGGTGGCCGG + Intronic
1026989461 7:74575447-74575469 AGTTCTGAGCAGAGGGTAACAGG + Intronic
1030298999 7:107956630-107956652 AGGCATAGGCAGAGGCTGACAGG - Intronic
1033681211 7:143598464-143598486 AGTTTGTAGCAGAGGGTGGCGGG + Intergenic
1033703680 7:143863349-143863371 AGTTTGTAGCAGAGGGTGGCGGG - Exonic
1033761764 7:144443314-144443336 AGGAATAGGCAGAGGCTGACAGG - Intergenic
1039766169 8:40630561-40630583 AGTATTTGGCAGTGGTTGACTGG + Intronic
1039947287 8:42140671-42140693 AGTTTGAGGCAGAGGCAGAACGG - Intergenic
1042084081 8:65088851-65088873 AGTTTTATGCACAGGCTGCCTGG + Intergenic
1043558913 8:81467786-81467808 AGTTTAAGGGAGAGGGTGGAAGG + Intergenic
1049151383 8:141037523-141037545 AGCTCCAAGCAGAGGGTGACAGG + Intergenic
1049153881 8:141055470-141055492 AGGTTGAGGCAGAGGGTGCCTGG + Intergenic
1049379552 8:142305229-142305251 AGCTGTGGGCAGAGGGTGCCAGG + Intronic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1053026145 9:34729926-34729948 TGTTTTAGGCAATGGGTGATTGG + Intergenic
1053295506 9:36910187-36910209 ATGTTTAGGCAGAGGGTGTGGGG - Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1056980893 9:91310293-91310315 AATTTTAGGTAGAGGCAGACAGG + Intronic
1061533355 9:131231986-131232008 AGCTGTAGGCAGAGGGTCTCTGG - Intronic
1192640255 X:72855613-72855635 AGTTGTAGGCAGAGGGGGATTGG + Intergenic
1192641456 X:72865163-72865185 AGTTGTAGGCAGAGGGGGATTGG - Intergenic
1194176436 X:90654931-90654953 AATTTTAGGCAGAGAGAGAGAGG - Intergenic
1194296859 X:92136748-92136770 ACTTTTAATCAGAGTGTGACGGG + Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196745355 X:119066934-119066956 AGTTTTGGGCAGAAGGTAAGAGG + Intergenic
1197655191 X:129109107-129109129 AGGTTCAGGAAGAGGCTGACAGG - Intergenic
1198435349 X:136611640-136611662 AGTGTTAGGCAAGGGGTGGCAGG + Intergenic
1200523062 Y:4235843-4235865 AATTTTAGGCAGAGAGAGAGAGG - Intergenic
1202576267 Y:26329023-26329045 AGTGCTAGGCAGAGGGCGATTGG + Intergenic