ID: 1175881990

View in Genome Browser
Species Human (GRCh38)
Location 20:62264799-62264821
Sequence CCCAGGACCCTCATGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175881982_1175881990 5 Left 1175881982 20:62264771-62264793 CCTCAGTGTCCCCGATGTCGTTT 0: 1
1: 0
2: 2
3: 2
4: 51
Right 1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG 0: 1
1: 0
2: 0
3: 27
4: 240
1175881984_1175881990 -5 Left 1175881984 20:62264781-62264803 CCCGATGTCGTTTCCTGTCCCAG 0: 1
1: 0
2: 0
3: 21
4: 117
Right 1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG 0: 1
1: 0
2: 0
3: 27
4: 240
1175881981_1175881990 24 Left 1175881981 20:62264752-62264774 CCACATGTCACTTGTATTTCCTC 0: 1
1: 0
2: 2
3: 27
4: 223
Right 1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG 0: 1
1: 0
2: 0
3: 27
4: 240
1175881983_1175881990 -4 Left 1175881983 20:62264780-62264802 CCCCGATGTCGTTTCCTGTCCCA 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG 0: 1
1: 0
2: 0
3: 27
4: 240
1175881985_1175881990 -6 Left 1175881985 20:62264782-62264804 CCGATGTCGTTTCCTGTCCCAGG 0: 1
1: 1
2: 1
3: 14
4: 117
Right 1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG 0: 1
1: 0
2: 0
3: 27
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175881990 Original CRISPR CCCAGGACCCTCATGGCATT TGG Intronic
901711989 1:11122948-11122970 CCCAAGAAACTCATGGCTTTGGG + Intronic
902806241 1:18863077-18863099 CCCAGAACCCCCATGGCAGGAGG - Intronic
903813316 1:26046605-26046627 CCCAGGACCCTCCTAGCAGGAGG - Intergenic
904378589 1:30096582-30096604 CCCAGCCCTATCATGGCATTAGG - Intergenic
904927762 1:34062043-34062065 GCCAGCACACTCATGACATTGGG - Intronic
905113610 1:35617460-35617482 CCCAGGGAACTCATGGAATTTGG - Intronic
905117566 1:35655447-35655469 CCCAGGAGCCTCCTGGCCTAGGG + Intergenic
905206225 1:36344222-36344244 CCCAGGGCCCACATGTCACTGGG + Exonic
910040774 1:82849143-82849165 CCCAGAATACTCATGGAATTAGG + Intergenic
912407960 1:109457357-109457379 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
915427764 1:155841653-155841675 CCCAGGTCCCTCATGTCCCTTGG - Intronic
916996309 1:170305414-170305436 CCCAGCACCCTTATGGCAACTGG + Intergenic
919393274 1:197014154-197014176 CCCAGGAGCCTCAGGATATTTGG + Intergenic
922527519 1:226317045-226317067 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
923686102 1:236154834-236154856 CCCGGGACCCTCCTGCCATAGGG + Intronic
923837627 1:237631461-237631483 CCCAGTGCCCTCATGAGATTAGG - Exonic
924448314 1:244155178-244155200 CCCTGGACCCTGAGGGCATGGGG + Intergenic
1062950146 10:1492861-1492883 CCCAGGCCTCTCATGGTACTTGG - Intronic
1064120652 10:12615216-12615238 CCCAGGTCCCTCAGGTGATTGGG + Intronic
1064129745 10:12698584-12698606 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1065755792 10:28929424-28929446 CCCAGGACCCTCATTTCTTTAGG - Intergenic
1067240918 10:44492480-44492502 CCTAGGACCCTCAGTGCTTTAGG - Intergenic
1067551027 10:47236647-47236669 CCCAGAACCCTCAGGGCACTGGG + Intergenic
1067748275 10:48952834-48952856 CATAGGACCCTCATGGCGTTGGG - Intronic
1068876780 10:62005488-62005510 CCCAGGAGCCTTAGGGAATTGGG - Intronic
1070173786 10:73953410-73953432 CCCTGGACCCTCCTGGCAGATGG - Intergenic
1070479021 10:76862965-76862987 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1072803751 10:98411050-98411072 CCAAGGATCTTCATGGCATGGGG - Intronic
1073476365 10:103756512-103756534 CCCAGGAGCCTCTGGGCACTGGG - Intronic
1075611857 10:123861053-123861075 CCCAGGGAGCTCATGGGATTGGG - Intronic
1075872048 10:125778110-125778132 CTCAGGACCCTCAGTGCAGTTGG - Intergenic
1075923220 10:126230158-126230180 CCCAAAGCACTCATGGCATTGGG + Intronic
1077028844 11:454283-454305 CCCAGCACCCTCCTGGCCCTGGG - Intronic
1077091318 11:779625-779647 TGCATGTCCCTCATGGCATTCGG + Intronic
1079282154 11:19097293-19097315 CACAGTACCCTCATGCCCTTTGG + Intergenic
1080753406 11:35171733-35171755 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1084202872 11:67573541-67573563 CCCAGGAACCTCAAGATATTTGG + Intergenic
1084675880 11:70634078-70634100 CCCAGGACCCACGTGGCACTTGG - Intronic
1085235221 11:75009446-75009468 CCCAGGGCCCTGAAGGCCTTGGG - Exonic
1087424880 11:97973005-97973027 CCCAGCACCCTGAAGGCACTGGG + Intergenic
1088581305 11:111319506-111319528 CCCAGGACCAGCATGGCAGGAGG - Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1089257926 11:117203802-117203824 CAGAGGACCCTGATGGCTTTGGG + Exonic
1089902694 11:122004522-122004544 CCCAGGTCCAATATGGCATTTGG + Intergenic
1091601044 12:1917998-1918020 CCCAGGAGCCGGATGGCTTTAGG - Intronic
1091842869 12:3633243-3633265 CCCAGGACCCTGCTGACAGTGGG + Intronic
1091853024 12:3715803-3715825 CCCAGGACCCTCATTTCTTTAGG - Intronic
1092902492 12:13072824-13072846 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1093908200 12:24716328-24716350 CCCAGGATCCAAGTGGCATTTGG + Intergenic
1096145714 12:49277293-49277315 CCCAGGACCCTTGGGGCATGAGG + Intergenic
1096707446 12:53431172-53431194 CCCAGGACCCTGATGGGCTGAGG + Exonic
1097721487 12:63026303-63026325 GACAGGACCCCCATGGCATAAGG + Intergenic
1098466563 12:70793854-70793876 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1098547201 12:71724855-71724877 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1099030757 12:77523668-77523690 CCCAGGAAGCTCTTGGGATTGGG + Intergenic
1100282749 12:93133926-93133948 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1101351112 12:103930507-103930529 CACAGGGCCCTCATGGCGTGCGG - Exonic
1103458431 12:121085551-121085573 CCAAGGACCGTCATGGCCTAAGG + Intergenic
1105248032 13:18670290-18670312 CCCTGGACCCTGATGACATTAGG - Intergenic
1106282834 13:28291374-28291396 CTCATGACCCTAATGGAATTTGG - Intronic
1107222445 13:38001055-38001077 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1108215852 13:48183684-48183706 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1108367327 13:49729022-49729044 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1110543508 13:76731314-76731336 CCAAAAACCTTCATGGCATTTGG - Intergenic
1112368561 13:98775356-98775378 GTCAGGCCCCTCTTGGCATTGGG + Intergenic
1113074670 13:106455611-106455633 CCCAGTAGCCCCCTGGCATTGGG - Intergenic
1114663916 14:24367712-24367734 CCCAGGACCCTCCTGGCCTCAGG + Intronic
1117031197 14:51672539-51672561 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1117467835 14:56011583-56011605 CCCAGGAGCCTCAGGTCTTTAGG + Intergenic
1117689140 14:58287376-58287398 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1118999289 14:70866720-70866742 CCCAGGAACCCCATGTCCTTGGG - Intergenic
1119965386 14:78909696-78909718 CCCAGGACCCTCAATTCTTTAGG + Intronic
1120345604 14:83285705-83285727 CCCAGGACCCTCAGTTCCTTAGG + Intergenic
1121241221 14:92431342-92431364 CCCAGGTCCCACAGGTCATTAGG + Intronic
1202842790 14_GL000009v2_random:138497-138519 CCCAGGAACCTCAAGTTATTTGG - Intergenic
1202912188 14_GL000194v1_random:128739-128761 CCCAGGAACCTCAAGTTATTTGG - Intergenic
1124611657 15:31213830-31213852 CTCAGCACCCTCAGGGAATTGGG - Intergenic
1124887141 15:33697916-33697938 CCCAGGACTCTCATGAGGTTGGG - Exonic
1125727869 15:41877267-41877289 CCCAGGACCCTCAGAGTGTTGGG + Exonic
1130053384 15:80502618-80502640 CCCATGTCCCACATGGCATGGGG - Intronic
1130954790 15:88620030-88620052 CCCAGGCCCCTGAAGGCTTTGGG - Intergenic
1131435022 15:92415460-92415482 GCCTGGACCCTAAAGGCATTTGG - Intronic
1132582389 16:690960-690982 CCCAGGTCCATCATGACATCTGG + Intronic
1133821689 16:9242832-9242854 CCAGGGACCCTCATGGAAATAGG - Intergenic
1135038607 16:19099507-19099529 CACAGGATCCTCTTGGCTTTGGG + Intergenic
1136343660 16:29661891-29661913 CCCAGGAGTCTCATGTCTTTGGG + Intergenic
1136415207 16:30098692-30098714 CCCAGGACCCTCAGTGGAATAGG + Intergenic
1136618601 16:31413270-31413292 CCCAGGCCCCTCATTCCATTAGG + Intronic
1138563329 16:57815266-57815288 CCCAGGACCCCCACAGCCTTGGG - Intronic
1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG + Intronic
1140015359 16:71176997-71177019 TCCAGGACCCTCATGCCAGGTGG - Intronic
1146102296 17:29994871-29994893 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1149307183 17:55359422-55359444 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1152392124 17:80009386-80009408 ACGAGGGCCCTCATGGCCTTGGG - Intronic
1153167548 18:2279834-2279856 TCCAGTGCCCTCACGGCATTCGG + Intergenic
1154440821 18:14388838-14388860 CCCTGGACCCTGATGACATTAGG + Intergenic
1156255311 18:35389881-35389903 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1156345981 18:36257586-36257608 CCAAGGACCCTAACAGCATTGGG + Intronic
1157752524 18:50192795-50192817 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1158270080 18:55703377-55703399 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1159389510 18:67771276-67771298 CCTAGGACCATGAGGGCATTGGG - Intergenic
1161305527 19:3565340-3565362 GCCAGGACCCTCCTGGCCTCAGG + Intronic
1162569799 19:11465433-11465455 CCCAGAAGCCTCAGGGCATGAGG - Intronic
1164290724 19:23866648-23866670 CCCAGGCCCCTCAAGCCATGAGG + Intergenic
1165073756 19:33269687-33269709 CCCAGGAACATCCTGGCCTTGGG + Intergenic
1165154022 19:33776841-33776863 CCCAGGATACTCAAGGCCTTTGG - Intergenic
1166122134 19:40692296-40692318 CCCAGGGCCCTTATGACTTTGGG - Exonic
1166789686 19:45391506-45391528 GCCAGGAGCCTCATTGCAATGGG - Intronic
927120924 2:19962051-19962073 CCCAGGACCCTCAGTTCTTTAGG + Intronic
927343198 2:22006258-22006280 CCCAGGACCCTCACTTCTTTAGG - Intergenic
928217575 2:29375027-29375049 CTCATCACCCTCTTGGCATTAGG + Intronic
928337833 2:30413340-30413362 CCCAAGCCCCTCAAGGCAATGGG + Intergenic
928899822 2:36304935-36304957 CACAGGACCCTCATGGAAACAGG + Intergenic
930678861 2:54233933-54233955 CCCAGGACCCTCAGTTCTTTAGG - Intronic
931437231 2:62258440-62258462 CCCAGGAACCTCAAGTTATTTGG - Intergenic
932095339 2:68842609-68842631 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
933472132 2:82739547-82739569 CCCAGGACACTGGTGCCATTTGG + Intergenic
934722950 2:96594573-96594595 CCCAGGAAACTTGTGGCATTAGG - Exonic
935923806 2:108044745-108044767 TCCAGGACCCTCATTTCTTTAGG - Intergenic
939889554 2:147720439-147720461 CCCATCACCCTCTTGGCATGAGG + Intergenic
941349728 2:164417249-164417271 CCCAGGAGTGTCATGGCTTTTGG - Intergenic
941619985 2:167766511-167766533 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
945841603 2:214893649-214893671 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
948665246 2:239530533-239530555 GCCAGGACCCTTATGCAATTGGG + Intergenic
1169748202 20:8964312-8964334 ACCTTGAGCCTCATGGCATTGGG - Intronic
1170552191 20:17487672-17487694 CCCAAAACTCACATGGCATTTGG - Intergenic
1170793846 20:19529658-19529680 CCCCGCACCATCATGGCACTTGG + Intronic
1171146327 20:22786693-22786715 CCACACACCCTCATGGCATTTGG - Intergenic
1171384091 20:24755802-24755824 CCCTTGACTCTCATGGCCTTAGG + Intergenic
1173201339 20:40957439-40957461 ACCAGGTCCCTCATGGCCCTGGG - Intergenic
1174554929 20:51387429-51387451 CCCAGGACCCTGATGGCTCAGGG + Exonic
1175402284 20:58707488-58707510 GCCTAGACCCTCATGGCATGTGG + Intronic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1176055364 20:63142858-63142880 CCCAGGACCCTCAGTGCCTTAGG - Intergenic
1176294217 21:5062149-5062171 CCCAGGAACCTCAGGGCTATCGG + Intergenic
1176455233 21:6902346-6902368 CCCTGGATCCTGATGACATTAGG - Intergenic
1176631545 21:9143416-9143438 CCCAGGAACCTCAAGTTATTTGG - Intergenic
1176833405 21:13767394-13767416 CCCTGGATCCTGATGACATTAGG - Intergenic
1176976361 21:15326599-15326621 CCCAGGGTCCACCTGGCATTGGG + Intergenic
1177085955 21:16704122-16704144 TCCAGGATCCTCATTCCATTTGG - Intergenic
1177714571 21:24822538-24822560 CCCAGAACACTCAGGGCACTAGG - Intergenic
1178902026 21:36605933-36605955 CCCAGGACCCTCATGTGCTAAGG - Intergenic
1179022866 21:37656009-37656031 TCCTGGACCCTCATGGACTTAGG + Intronic
1179863042 21:44201499-44201521 CCCAGGAACCTCAGGGCTATCGG - Intergenic
1180387431 22:12191277-12191299 CCCAGGAACCTCAAGATATTTGG - Intergenic
1180856922 22:19053223-19053245 CCCTGGATCCTCAGGGCACTGGG + Intronic
1181313487 22:21957889-21957911 CACATGACCCTCATGTCACTGGG + Intronic
1181346593 22:22223961-22223983 CACATGACCCTCATGTCACTGGG + Intergenic
1182473478 22:30562673-30562695 CCCATGACCCTCAGGGCAGAAGG + Intronic
1183378378 22:37478338-37478360 CCCAGGACCCCCTGGGCATCAGG - Intronic
1183991085 22:41597398-41597420 CCCAAGACCAGCCTGGCATTGGG + Intergenic
1184134130 22:42536364-42536386 CCCAGGAGGCCCATGGCATGAGG - Intergenic
1184243407 22:43223267-43223289 CCCAGGACCCTCCTGGCTCCAGG - Intronic
949408736 3:3741406-3741428 CCCAGGACCTAGCTGGCATTTGG + Intronic
951821990 3:26824236-26824258 CCCAGGAGCCTCATGTTCTTGGG + Intergenic
954213772 3:49112790-49112812 ACCAGGCTCCTTATGGCATTGGG - Intronic
954222688 3:49164195-49164217 ACCACCACACTCATGGCATTAGG + Exonic
954393248 3:50278602-50278624 ATCAGAGCCCTCATGGCATTGGG + Intergenic
954935509 3:54323147-54323169 CTCAGGACCCATATGCCATTTGG + Intronic
955656790 3:61252338-61252360 TCCAGCACCCACATGGCATTTGG - Intergenic
956164899 3:66389911-66389933 CCCAGGACCCTCAGTTCTTTAGG - Intronic
956923638 3:73958130-73958152 CCCACGACCCTCATTTCTTTAGG + Intergenic
957098375 3:75799214-75799236 CCCAGGAACCTCAAGATATTTGG - Intergenic
957762885 3:84582407-84582429 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
959451291 3:106506292-106506314 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
959934055 3:112011783-112011805 CAGAGGACCCTGATGGCTTTAGG + Exonic
959998041 3:112699511-112699533 ACCAAGACACTCATTGCATTTGG + Intergenic
962375013 3:134852055-134852077 CCCATGTCCCTCCTGGCAGTCGG + Intronic
967122888 3:186399451-186399473 CCCAGAAGCCTCATGGTCTTTGG + Intergenic
969125651 4:4945931-4945953 CCCTGGGCTCCCATGGCATTTGG + Intergenic
971252319 4:24983736-24983758 GCCAAGTCCCTCATGGCATGAGG + Intergenic
972714758 4:41634477-41634499 CCAAGGACCCTGATGGCAGTGGG + Intronic
974385051 4:61193481-61193503 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
976139147 4:81972101-81972123 CCCAGGCTCCTGATGGCACTGGG + Intronic
977156839 4:93584713-93584735 CCCAGGACCCTCAGTTCTTTAGG - Intronic
979359847 4:119748711-119748733 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
980651617 4:135724396-135724418 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
981324446 4:143429546-143429568 CCCAGGACCCACATGTTCTTGGG - Intronic
983602799 4:169549081-169549103 CCCAGGGCCCTGGTGGCATAGGG + Intronic
985644422 5:1078293-1078315 CCCAGGACCCCCGGGGCCTTGGG + Intronic
985945012 5:3174759-3174781 CCCAGGACCCTCAGTCCTTTAGG + Intergenic
988047057 5:25970061-25970083 CCCAGGAACCTCAAGATATTAGG + Intergenic
988316767 5:29641320-29641342 CCCAGGACTCTCAGGTCTTTCGG - Intergenic
988604898 5:32670541-32670563 CTCAGGATCCTCATGCCAGTCGG - Intergenic
989786781 5:45342060-45342082 CCCAGGACCCTCAATTCTTTAGG + Intronic
990663790 5:58049098-58049120 CCCAACTCCCTAATGGCATTTGG + Intergenic
991609513 5:68435874-68435896 CCCACCACACTCAGGGCATTGGG - Intergenic
994328939 5:98483481-98483503 CCCAGCATCCTCAAGGCAGTGGG + Intergenic
997276083 5:132592291-132592313 CCCAGGACCCTCAGTTCTTTAGG - Intronic
997412690 5:133702403-133702425 CCCTGGAACCTCAGAGCATTGGG + Intergenic
998409091 5:141894920-141894942 CCCAGGAAACTCAGGGTATTTGG + Intergenic
998928393 5:147153386-147153408 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1001138635 5:169124175-169124197 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1001976452 5:176003777-176003799 CCCAGGACCCTCAGTTCTTTAGG - Intronic
1005248528 6:23916658-23916680 CTCAGGAACCTCAGGGGATTAGG + Intergenic
1006950574 6:37819027-37819049 CCCAGGCCCCTCCTCGCACTCGG + Intergenic
1007844265 6:44740702-44740724 CCCAGAACCCACATGGCACGTGG + Intergenic
1012231723 6:96768290-96768312 CCCAGGAGCCACATGGGATAAGG + Intergenic
1014998525 6:128184582-128184604 TCCAGGATCCTGATGTCATTCGG + Exonic
1016148974 6:140714705-140714727 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1016785504 6:148006582-148006604 CCCAGGCTCCTCATGGTTTTGGG + Intergenic
1016814021 6:148287087-148287109 CCCAGGTCTCTGATGGCATCAGG + Intronic
1017313138 6:152997945-152997967 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1017344058 6:153358619-153358641 CCCAGGACCCTCAGTTCCTTAGG + Intergenic
1017510578 6:155111224-155111246 CCGAGGAAACTCATGACATTAGG + Intronic
1017838021 6:158197896-158197918 CCCAGGACCCTCAGTTCTTTAGG + Exonic
1019034481 6:169042971-169042993 CCCAGCACCCTCATGCCTTAGGG + Intergenic
1019275190 7:172485-172507 CCAGGGACCCTCATGGCAGCTGG - Intergenic
1030379789 7:108799310-108799332 CCCAGGTCTCTCATGGCATCAGG + Intergenic
1033570339 7:142621657-142621679 CCAAGGACCTTCATGGCGGTGGG + Intergenic
1034704371 7:153127418-153127440 CCCCCCACCCTCATGGCATTGGG + Intergenic
1035081591 7:156220637-156220659 CCCAACATCCTCTTGGCATTTGG - Intergenic
1036405943 8:8455374-8455396 AGCAGGACCCACAGGGCATTGGG + Intergenic
1036709369 8:11068399-11068421 GTCAGGACACTAATGGCATTTGG - Intronic
1037878918 8:22563420-22563442 TCCAGCACCCTCATGGAACTAGG + Intronic
1038853508 8:31304622-31304644 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1039402847 8:37286067-37286089 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1039802607 8:40972904-40972926 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1043422128 8:80109129-80109151 CCCAGGAACCTCAAGATATTTGG + Intronic
1044212538 8:89566666-89566688 CCCAAGAATCTCATGCCATTTGG + Intergenic
1044679394 8:94762378-94762400 CACAGGACCCTCAAGCCATCAGG + Intronic
1047882597 8:129212735-129212757 CCCATGACCATCATAGCTTTAGG - Intergenic
1048489043 8:134874878-134874900 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1049200623 8:141338617-141338639 CCTAGGACACTCAGGGCCTTGGG - Intergenic
1049220907 8:141428382-141428404 CCCAGGACCCCCTGGGCAGTGGG - Intronic
1049382358 8:142323652-142323674 CCCAGGACCAGCAGGGCACTTGG + Intronic
1050364422 9:4861156-4861178 CCCAGGATCCTCATGTCTTCTGG - Intronic
1050926832 9:11274364-11274386 CCCAGGATCCTCATGTTTTTAGG + Intergenic
1050929600 9:11306892-11306914 CCCAGGAACCTTATGGTCTTTGG + Intergenic
1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG + Intergenic
1052585839 9:30426093-30426115 CCCAAGACCATCAAGGCAATAGG + Intergenic
1053309633 9:37008816-37008838 ACCAGAAAACTCATGGCATTTGG + Intronic
1054952377 9:70867030-70867052 CCCAGGAGTATCCTGGCATTTGG + Intronic
1056419808 9:86413219-86413241 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1056559374 9:87716864-87716886 CCCAGGAGCCTGTTGGAATTTGG + Intergenic
1056568762 9:87797938-87797960 CCCAGGAGCCTGTTGGAATTTGG - Intergenic
1057443552 9:95098563-95098585 CCCAGGACCCCCACTGCAGTGGG - Intergenic
1057505151 9:95627468-95627490 CCCAGGACCCTCCTGTCAGCAGG + Intergenic
1057726728 9:97573238-97573260 CCCAGGACCCCCAGGGCACCAGG + Intronic
1059551221 9:115231460-115231482 CCCAGAACACCCATGGCCTTAGG + Intronic
1060591592 9:124820475-124820497 CCCATCACCCTCCTGGCACTTGG + Intergenic
1060741080 9:126097950-126097972 CCCCAGGCCCTCATGGCAGTGGG - Intergenic
1062038469 9:134393183-134393205 CCCAGGTCGCTCATGGCTTTAGG - Intronic
1203688242 Un_GL000214v1:16699-16721 CCCAGGAACCTCAAGATATTTGG + Intergenic
1203754374 Un_GL000218v1:111020-111042 CCCAGGAACCTCAAGTTATTTGG - Intergenic
1203648033 Un_KI270751v1:87354-87376 CCCAGGAACCTCAAGATATTTGG - Intergenic
1186337839 X:8610111-8610133 CCCAGGACCCTCAATTCTTTAGG + Intronic
1186691634 X:11983923-11983945 CCCAGGACCCTCAGTTCTTTAGG - Intergenic
1188649946 X:32620041-32620063 CCCAGGTTCCTCTTGGCCTTTGG - Intronic
1188734253 X:33693045-33693067 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1190056620 X:47185006-47185028 CCCAGAACCCTCATGACCCTGGG - Intronic
1190908761 X:54753268-54753290 CCCAGGACCCTCAGTTCTTTAGG + Intronic
1192531149 X:71887393-71887415 CCCAGGACCCTCAGTTCTTTAGG + Intergenic
1195350789 X:103994960-103994982 CCCAGGAACCTCAGGTAATTTGG + Intergenic
1197777257 X:130126531-130126553 CCCAGGATCCTCAGGGGCTTGGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201168005 Y:11228668-11228690 CCCAGGAACCTCAAGTTATTTGG - Intergenic