ID: 1175882706

View in Genome Browser
Species Human (GRCh38)
Location 20:62270116-62270138
Sequence CAGGGTGGACGGAGGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1477
Summary {0: 1, 1: 0, 2: 8, 3: 130, 4: 1338}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175882706_1175882716 5 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882716 20:62270144-62270166 GCAGTGCCTGTGGTGTCCTGAGG 0: 1
1: 0
2: 3
3: 38
4: 283
1175882706_1175882721 16 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882721 20:62270155-62270177 GGTGTCCTGAGGCCTTGGTGGGG 0: 1
1: 0
2: 1
3: 32
4: 278
1175882706_1175882714 -5 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882714 20:62270134-62270156 CCCTGCGCATGCAGTGCCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 200
1175882706_1175882718 11 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882718 20:62270150-62270172 CCTGTGGTGTCCTGAGGCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 323
1175882706_1175882720 15 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882720 20:62270154-62270176 TGGTGTCCTGAGGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 209
1175882706_1175882719 14 Left 1175882706 20:62270116-62270138 CCGCCCACCCTCCGTCCACCCTG 0: 1
1: 0
2: 8
3: 130
4: 1338
Right 1175882719 20:62270153-62270175 GTGGTGTCCTGAGGCCTTGGTGG 0: 1
1: 0
2: 3
3: 16
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175882706 Original CRISPR CAGGGTGGACGGAGGGTGGG CGG (reversed) Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
900110887 1:1005151-1005173 CAGGAAGGAGGGAGGGTGAGGGG - Intergenic
900157433 1:1208881-1208903 CAGGCAGGATGGCGGGTGGGTGG - Intergenic
900417241 1:2540765-2540787 CGGGGCGCACGGGGGGTGGGGGG - Intergenic
900427423 1:2586955-2586977 CCGGGTGGACGCAGGGCGGTGGG + Intronic
900465395 1:2822766-2822788 TAGAGTGGACAGAGGCTGGGAGG + Intergenic
900521165 1:3106146-3106168 CAGGGTGGGCGGGGTATGGGGGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900863066 1:5246450-5246472 AAGGGAGGAGGGAGGGAGGGTGG - Intergenic
900966010 1:5959133-5959155 CATGGTGTCCGGAGGGAGGGAGG - Intronic
900992984 1:6106547-6106569 CTGGGTGGAGGCTGGGTGGGGGG - Intronic
901006646 1:6174930-6174952 AAGGATGGATGGTGGGTGGGTGG + Intronic
901006695 1:6175157-6175179 GATGGTGGGCGGATGGTGGGTGG + Intronic
901019470 1:6248575-6248597 CAGGGGGCACTGAGAGTGGGAGG + Exonic
901020006 1:6250628-6250650 TAGGGTGGGGGGTGGGTGGGGGG + Intronic
901055305 1:6446384-6446406 AGGGCTGGAAGGAGGGTGGGGGG + Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901224185 1:7602147-7602169 AAGGGAGGAGGGAGGGAGGGAGG - Intronic
901445438 1:9305319-9305341 CAGGGTGGACCGTGGATGGCAGG - Intronic
901453813 1:9352080-9352102 GGGGGTGGAGGGAAGGTGGGTGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901657729 1:10779985-10780007 CAGGGTGGGCGGGGTGTTGGTGG - Intronic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
902328554 1:15718672-15718694 CAGGGTGGGGGCAGGGTGGGCGG + Intronic
902388613 1:16089915-16089937 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
902628347 1:17689599-17689621 GAGGGAGGAAGGAGGGAGGGAGG - Intronic
902628353 1:17689614-17689636 AAGGGAGGAAGGAGGGAGGGAGG - Intronic
902767796 1:18628803-18628825 CAGGGTGTGCCAAGGGTGGGAGG - Intergenic
902799085 1:18818385-18818407 TAGGGTGGAGGGAGGGCTGGAGG + Intergenic
903038865 1:20513374-20513396 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903568578 1:24287037-24287059 GAGGGTGGGCGGAGGGCGGTGGG - Intergenic
903651492 1:24925243-24925265 CAGGGAGGAAGGAGGGTGCCGGG - Intronic
903788976 1:25879898-25879920 CAGACTGGACTGAGGATGGGGGG - Intergenic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904312007 1:29635119-29635141 GGAGGTGGATGGAGGGTGGGTGG - Intergenic
904497600 1:30895854-30895876 GAGGGTGGGAGGAGGGAGGGAGG + Intronic
904534604 1:31190811-31190833 CAGGGTGGAAGGAGGAAGAGTGG - Intronic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
904880158 1:33690295-33690317 CAAGGAGGAAGGTGGGTGGGAGG - Intronic
905307853 1:37031908-37031930 CAGTTTGGGCGGAGGATGGGAGG - Intronic
905647235 1:39633156-39633178 CAGGCGGGGCGGAGGGCGGGCGG - Intronic
905876547 1:41435419-41435441 GTGGCTGGATGGAGGGTGGGAGG + Intergenic
906141307 1:43535365-43535387 CAGGGCCCAGGGAGGGTGGGAGG - Intronic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
906515398 1:46436075-46436097 CAGGGAGGAATGATGGTGGGGGG - Intergenic
906956616 1:50380854-50380876 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
907405605 1:54251761-54251783 CAGGGTGGGCCTAGGGTGGCTGG - Intronic
907437497 1:54458968-54458990 CAGGCGGGAAGGAGGGAGGGAGG + Intergenic
907437523 1:54459060-54459082 CAGGCAGGAAGGAGGGAGGGAGG + Intergenic
907526340 1:55056239-55056261 GAGGGCGGAGGGAGGGCGGGCGG + Intronic
907697105 1:56742503-56742525 CAGGAAGGAGGGAGGGTGGAAGG - Intronic
908391393 1:63686831-63686853 ATGGATGGATGGAGGGTGGGTGG - Intergenic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
909607620 1:77522587-77522609 CAGGGAGGTGGGATGGTGGGAGG - Intronic
910004066 1:82373543-82373565 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
910205176 1:84742539-84742561 GAGGATGGAGGAAGGGTGGGGGG + Intergenic
910679139 1:89844191-89844213 CAGGGTGGTGGGAGGGTAAGGGG + Intronic
910836561 1:91518734-91518756 AAGGGTGGTGGGAGGGTGTGGGG + Intronic
910897932 1:92087307-92087329 ATGGGGGGAAGGAGGGTGGGAGG + Intronic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
911618292 1:100038410-100038432 CAGGGTGGGGGAAGGGAGGGAGG - Intronic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912151207 1:106860788-106860810 GAGGAGGGACGGAGGGAGGGAGG + Intergenic
912239200 1:107887163-107887185 CAGGTTGGACGGAGCATTGGTGG - Intronic
912308532 1:108595659-108595681 CATGCTGGAAGGAGGGAGGGAGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912680635 1:111726887-111726909 TGGGGAGGAGGGAGGGTGGGCGG - Exonic
914351348 1:146842932-146842954 GAGGGTGGATGGATGATGGGTGG + Intergenic
914424520 1:147562763-147562785 GAGTGTGGACGGGGGGTGGCAGG + Intronic
914872523 1:151487208-151487230 AAGGGAGGAAGGAGGGAGGGAGG - Intergenic
915224738 1:154404234-154404256 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
915302805 1:154961399-154961421 CAGAGGGGAGGGATGGTGGGCGG - Intronic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915321141 1:155057113-155057135 CAGGATGGAGAGAGGGTGTGGGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915516323 1:156414698-156414720 CACGGAGGAAGGAGGGTGGGAGG + Exonic
915626799 1:157118812-157118834 CAGGGTTGAAGGAAGGTGGGAGG + Intergenic
915934936 1:160084906-160084928 CGGGGTTGGCAGAGGGTGGGCGG + Intronic
916007775 1:160677725-160677747 CAGGCTGGGCTCAGGGTGGGGGG + Intergenic
916021238 1:160794344-160794366 CAGAGTGGAGGGAGAATGGGTGG - Intergenic
916309448 1:163378910-163378932 CAAGGTAGGCGGTGGGTGGGGGG + Intergenic
916424555 1:164668434-164668456 CATGGTGGAGGTGGGGTGGGTGG - Intronic
916976556 1:170086661-170086683 GAGGGAGGAAGGAGGGAGGGAGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917073163 1:171174977-171174999 AAGGATGGAGGGAGGGAGGGAGG + Intergenic
917987875 1:180339531-180339553 TAGGGTGGAAGGAGGGAGGGAGG + Intronic
918782396 1:188718148-188718170 AAGGGTGGGAGGAGGGTGAGGGG - Intergenic
919649185 1:200128693-200128715 CAGGGTGGAGTGGGGGTGGTGGG + Intronic
919879885 1:201894569-201894591 CAGGCAGGAGTGAGGGTGGGAGG + Intergenic
920127162 1:203702442-203702464 CATGGTGGAGGGAGGTGGGGTGG + Intronic
920214381 1:204351454-204351476 CAGGAAGGGCGGAGGGTGAGAGG - Intronic
920305391 1:205015191-205015213 CAGGAAGGACTGGGGGTGGGTGG + Intronic
920685306 1:208104656-208104678 TAGGGTGTACAGTGGGTGGGAGG + Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
920951819 1:210579132-210579154 CACGGGAGATGGAGGGTGGGAGG + Intronic
921833955 1:219759091-219759113 AAGGGAGGAGGGAGGGAGGGAGG + Intronic
921838136 1:219799173-219799195 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
921942140 1:220853464-220853486 AAGGAGGGAAGGAGGGTGGGAGG - Intergenic
922618780 1:226978338-226978360 TCGGGTGGGTGGAGGGTGGGTGG - Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922894581 1:229090199-229090221 CAAGGAGGAAGGAGGGTGGAGGG - Intergenic
923189543 1:231607235-231607257 GAGGGTGGAGGGTGGGTGGGGGG - Intronic
923232879 1:232005069-232005091 AAGGGAGGAGGGAGGGAGGGAGG - Intronic
923433936 1:233950602-233950624 AAGGGTGGAGGGATGGAGGGAGG - Intronic
923724626 1:236495521-236495543 GAGGGTGGAGGGAGGCGGGGTGG - Intergenic
923724636 1:236495543-236495565 GAGGGTGGAGGTGGGGTGGGTGG - Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923803145 1:237229853-237229875 CAGAGTGGACGCAGGGTTGGTGG - Intronic
924436542 1:244048531-244048553 AGGGGCGGACTGAGGGTGGGGGG + Intergenic
924462122 1:244269061-244269083 CAGGGAAGACGCAGGGTGTGAGG - Intergenic
1062771461 10:104817-104839 CAGGGTGGAAGGGCGGGGGGGGG - Intergenic
1062822959 10:548437-548459 CGGGATGGAGGGAGGGAGGGAGG + Intronic
1062928351 10:1335232-1335254 AAGGAGGGATGGAGGGTGGGAGG + Intronic
1062991967 10:1827777-1827799 GATGGTGGAGGGAGGGTGGAAGG + Intergenic
1063100897 10:2949444-2949466 CAAGGAGGAAGGAGGGAGGGAGG + Intergenic
1063423052 10:5928995-5929017 CAGGGTGCAGGCAGGGTGGGCGG + Intronic
1063428598 10:5968335-5968357 CAGGCTGGGGGCAGGGTGGGAGG + Intronic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063958246 10:11284784-11284806 GATGGTGGATGGATGGTGGGCGG + Intronic
1064300346 10:14117661-14117683 GAAGGTGGAAGGAGGGTGGAAGG + Intronic
1064442218 10:15364038-15364060 TCGGGTGGGTGGAGGGTGGGGGG + Intronic
1064962121 10:20976769-20976791 AAGGGAGGAGGGAGGGAGGGAGG + Intronic
1065200546 10:23308936-23308958 AGGGGTGGAAGGTGGGTGGGTGG - Intronic
1065341526 10:24711135-24711157 AAGGAGGGAGGGAGGGTGGGAGG + Intronic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1065905627 10:30248535-30248557 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1066004524 10:31134230-31134252 CTGCGTGGAGGGGGGGTGGGGGG + Intergenic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067726272 10:48773679-48773701 CAGGATGATGGGAGGGTGGGCGG + Intronic
1067776179 10:49166413-49166435 AAGTGTGGGCGGATGGTGGGAGG - Intronic
1068431688 10:56941422-56941444 GAGGATGGAGGGAGGGAGGGAGG + Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068983045 10:63081443-63081465 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1069627527 10:69877387-69877409 CAAGGTGGAGGGAGGGGGCGTGG - Intronic
1069637750 10:69936037-69936059 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
1069674009 10:70234110-70234132 CAGGGGGGATGGAGGGGGCGGGG - Intergenic
1069724366 10:70567668-70567690 AAGGGTGCACTGAGGGTGGTGGG + Exonic
1069917324 10:71795703-71795725 CGGGGTGGGAGGAGGGAGGGAGG - Intronic
1069920326 10:71812151-71812173 GAGGGTGGAGGGAGGGTGAAGGG - Intronic
1069941929 10:71962534-71962556 CATAGTGAATGGAGGGTGGGGGG + Intergenic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1070555937 10:77527792-77527814 CAGGGTGGAGGGTGGCTGAGTGG + Intronic
1070560551 10:77563573-77563595 CAGGATGGAGGGAGGGTAGAAGG - Intronic
1070635116 10:78119327-78119349 CAGGTAAGAAGGAGGGTGGGAGG - Intergenic
1070660177 10:78300030-78300052 CAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070796325 10:79219027-79219049 CAGATTGCACGGGGGGTGGGGGG + Intronic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071335881 10:84600230-84600252 CAGGTTCCACGCAGGGTGGGAGG - Intergenic
1071550305 10:86561408-86561430 CAGGGTGGGGGGTGGGGGGGCGG + Intergenic
1072003407 10:91220122-91220144 GAGGGTGGGGGGAGGGTGAGTGG - Intronic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1073185511 10:101613142-101613164 CCGGGTGGGGTGAGGGTGGGGGG - Intronic
1073487212 10:103827121-103827143 CAGGGTGGATGAGGGGTGGGAGG + Intronic
1073876343 10:107926451-107926473 GAGGGTGGACGGTGGGAGGAGGG + Intergenic
1073955721 10:108869073-108869095 GTGGGTGGACAGAGTGTGGGTGG + Intergenic
1074258959 10:111832697-111832719 CAGGGTGGGAGGAGGGTGACAGG + Intergenic
1074602291 10:114927097-114927119 GAGGGGGGAGGGAGGGGGGGAGG + Intergenic
1074609138 10:115004457-115004479 AAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1075162531 10:120037096-120037118 GAGGGTGGAAGGTGGGTGGAGGG + Intergenic
1075333053 10:121588240-121588262 GAGGGTGGAGGGTGGGTGGGAGG + Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075498810 10:122953840-122953862 CGGGGTGGGCGGAGGGGGGTGGG - Intronic
1075712135 10:124536450-124536472 CAGGGTGGAGGGAGAGGGGCCGG - Intronic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1076024376 10:127100200-127100222 CAGCGTGGAGGCAGGGAGGGCGG + Intronic
1076101636 10:127784953-127784975 GAGGGTGGGAGGAGGTTGGGAGG + Intergenic
1076103030 10:127797833-127797855 CGGGATGGTGGGAGGGTGGGGGG - Intergenic
1076109161 10:127848232-127848254 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1076616552 10:131759045-131759067 CAGGGCTGGGGGAGGGTGGGCGG - Intergenic
1076667739 10:132102645-132102667 GAGGGTGAAAGGAGGGTCGGAGG - Intergenic
1076719394 10:132386660-132386682 CAGGGTGGAGGGTGGGTGCCAGG - Intergenic
1076779645 10:132717156-132717178 CGTGGTGGAGGGAGGGAGGGAGG + Intronic
1076867468 10:133175118-133175140 ATGGGTGGATGGATGGTGGGTGG + Intronic
1076880036 10:133235640-133235662 GGGGGTGGACGGAGGCTTGGAGG + Intergenic
1076998923 11:312528-312550 AGGGGTGGGTGGAGGGTGGGGGG + Intronic
1077034413 11:487904-487926 CAGGGTGAGCGTGGGGTGGGTGG - Intronic
1077150825 11:1072398-1072420 CAGGGTGGGGAGAGGCTGGGGGG + Intergenic
1077274622 11:1698287-1698309 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1077315034 11:1915778-1915800 GAGGGTGGATGAAGGGAGGGAGG + Intergenic
1077357434 11:2125067-2125089 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357455 11:2125158-2125180 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357473 11:2125256-2125278 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357492 11:2125354-2125376 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357565 11:2125722-2125744 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357586 11:2125813-2125835 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357604 11:2125911-2125933 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357624 11:2126006-2126028 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357660 11:2126194-2126216 GTGGGTGGATGGAGGGTGCGTGG + Intergenic
1077385979 11:2269695-2269717 CAGGGAGGAGGGAGGGCCGGGGG - Intronic
1077463915 11:2724451-2724473 CTTGGAGGAAGGAGGGTGGGAGG + Intronic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1077555566 11:3224440-3224462 CTGGGAGGAAGGAGGGAGGGAGG - Intergenic
1077958645 11:7049013-7049035 GAGGGTGGAGGGTGGGTGGTGGG + Intronic
1078005074 11:7526532-7526554 TAGGCTGGAGTGAGGGTGGGAGG + Intronic
1078488592 11:11747765-11747787 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080249215 11:30214182-30214204 GAGGGTGGAGGGTGGGAGGGGGG - Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080466710 11:32504136-32504158 CATGGGGGAGGGAGGGAGGGAGG + Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1081102655 11:39024425-39024447 AAGGGAGGAGGGAGGGAGGGTGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1082160943 11:48886831-48886853 GAGGGCGGAGAGAGGGTGGGGGG + Intergenic
1082161423 11:48893575-48893597 GAGGGCGGAGAGAGGGTGGGGGG - Intergenic
1082244856 11:49910508-49910530 CAGACACGACGGAGGGTGGGAGG - Intergenic
1082266279 11:50121907-50121929 TGGGGTGGAGGGAGGGGGGGAGG + Intergenic
1082289810 11:50356665-50356687 TGGGGTGGAGGGAGGGGGGGAGG - Intergenic
1082656634 11:55865951-55865973 GAGGGAGGAGAGAGGGTGGGGGG - Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1083114086 11:60441277-60441299 TGGGGTGGAGGGAGGGGGGGAGG + Intronic
1083221839 11:61257879-61257901 AAGGGTGGAGGGAGGGTAGAGGG + Intergenic
1083343196 11:61972135-61972157 CACTGTGGAGGGAGGGAGGGAGG + Intergenic
1083443537 11:62692141-62692163 CAGGGATGATGGAGGGTTGGGGG + Intronic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1083742107 11:64716539-64716561 CCGTGTGGAGGGAGAGTGGGAGG + Intronic
1084006568 11:66326429-66326451 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1084403002 11:68955976-68955998 CAGGGTGGGGGTAGGGTGGGGGG + Intergenic
1084422516 11:69067394-69067416 CAGGCTGGGCGGCGGGTGGATGG + Intronic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085476743 11:76793947-76793969 CAGACTGGAAGGTGGGTGGGAGG - Intronic
1085508663 11:77074357-77074379 CTGGGTGGGCGGAGCCTGGGGGG - Intronic
1085787598 11:79468762-79468784 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086051082 11:82591193-82591215 CAGAATGGTGGGAGGGTGGGAGG - Intergenic
1086526395 11:87732230-87732252 GAGGGTGGAGGGTGGGGGGGGGG - Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1086903221 11:92390783-92390805 CTGGGAGGACTGAGGGTGAGAGG + Intronic
1087142279 11:94776494-94776516 AAGGGTGGAGGAAAGGTGGGAGG - Intronic
1087953184 11:104251235-104251257 TGGGGTGGAGGGAGGGTGGAGGG - Intergenic
1088550730 11:111009958-111009980 CAGGGTGGATTGAGGGATGGGGG + Intergenic
1088616566 11:111635480-111635502 GAGGGCGGAGGGAGGGAGGGAGG + Intronic
1088868045 11:113867800-113867822 AAGGGGGGAGGGAGGGAGGGAGG + Intronic
1089306869 11:117531933-117531955 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
1089333163 11:117704122-117704144 AAGGGAGGAGGGAGGGAGGGAGG + Intronic
1089363530 11:117907114-117907136 AGGGGTGGAGGGTGGGTGGGAGG + Intronic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089506922 11:118969543-118969565 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089656170 11:119948512-119948534 CATGGTGGATGGAGGGTGACAGG + Intergenic
1089812385 11:121142716-121142738 CAGGGTGCATGGAGGGTGAGAGG - Intronic
1090020646 11:123125477-123125499 AAGGGAGGAAGGAGGGAGGGAGG - Intronic
1090244645 11:125207212-125207234 AAGGGAGGAGGGAGGGTGGAAGG - Intronic
1090752567 11:129760326-129760348 CAGGTTGGAGGGAAGCTGGGAGG - Intergenic
1090787000 11:130058346-130058368 GAGGGTGGGAGGAGTGTGGGAGG - Intergenic
1091305479 11:134533196-134533218 CAGGCTGCAGGGAGAGTGGGGGG + Intergenic
1091360664 11:134976554-134976576 CTGGGTGGAGGGAGGGTGCCCGG - Intergenic
1091416853 12:295376-295398 GAGGGAGGAAGGAGGGAGGGAGG + Intronic
1091609635 12:1994904-1994926 CATGGTGGGTGGGGGGTGGGAGG - Intronic
1091863694 12:3810616-3810638 AAGGGAGGAGGGAGGGAGGGAGG + Exonic
1092102755 12:5899872-5899894 CAGGGAGGAGGGATGGTGGGAGG + Intronic
1092170591 12:6371545-6371567 GAGGGTGGACGGTGGGGGTGGGG + Intronic
1092173270 12:6386175-6386197 GAGGGTGGAAGGAGCTTGGGTGG - Intronic
1092698578 12:11201749-11201771 GAGGGTGGAGGGAGGGAGAGAGG + Intergenic
1092724391 12:11470798-11470820 GAGGGTGGACGGTGGGAGGAGGG + Intronic
1092915617 12:13186511-13186533 CAGGGTGGATGCAAGGAGGGAGG + Intergenic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1093886644 12:24468944-24468966 CAGGGTGGAAGGATGGTTTGAGG + Intergenic
1094564799 12:31590319-31590341 CCGGGTGGCTGGCGGGTGGGAGG + Intronic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1096406438 12:51347313-51347335 GAGGGTAGATGGAGGGTGGAGGG + Intergenic
1096487821 12:51995362-51995384 CAGGGTGGAGGGAAGGTGAGAGG + Intronic
1096513163 12:52143057-52143079 CCCGGTGGAGAGAGGGTGGGCGG + Intergenic
1096522247 12:52191107-52191129 CAGGGTGGAGGGTGAGTGCGGGG - Intronic
1096623639 12:52879808-52879830 CATGGTGGGGGGTGGGTGGGGGG - Intergenic
1096769070 12:53921477-53921499 CAGGCCTGTCGGAGGGTGGGAGG + Intergenic
1096876144 12:54631921-54631943 CTGGGTGGAGTGGGGGTGGGGGG - Intronic
1096924541 12:55128958-55128980 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097248873 12:57621494-57621516 GAGGAAGGACGGAGGGTGGAGGG + Intronic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098823701 12:75266915-75266937 TAGGGTGGTTGGAGGGTGGGTGG + Intergenic
1099324022 12:81189069-81189091 CAGGGTGGTTGGAGGGGGAGAGG - Intronic
1100209018 12:92381914-92381936 GAGGGGGGATGGAGGGAGGGAGG + Intergenic
1100272902 12:93043488-93043510 GAGGGAGGAGGGAGGGAGGGTGG - Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100370863 12:93967222-93967244 AAGGATGGAGGGAGGGAGGGAGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100616334 12:96234486-96234508 GTGGGTGGACGGCGGGTGGTGGG - Intronic
1101272200 12:103159600-103159622 CAGGGAGGGTGGAGGTTGGGGGG - Intronic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1102390174 12:112543307-112543329 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1102501179 12:113353630-113353652 AAGAGTGGAGGGAGGGAGGGAGG - Intronic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1103567699 12:121825111-121825133 AAGGGTGGTCTGAGGATGGGCGG + Intronic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104365531 12:128173212-128173234 GTGGGTGGTTGGAGGGTGGGAGG + Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104537371 12:129630847-129630869 GAGGGTGGAGGGTGGGTGGAGGG - Intronic
1104581109 12:130011449-130011471 GTGTGTGCACGGAGGGTGGGAGG - Intergenic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1104766095 12:131331220-131331242 AATGGTGGATGGGGGGTGGGTGG - Intergenic
1104833060 12:131767832-131767854 GAGGGTGGAGGGAGGGAGGGAGG + Intronic
1104896239 12:132166394-132166416 CTGGGTGGATGAAGGATGGGTGG - Intergenic
1104932006 12:132344944-132344966 CAGGATGGAGGGGAGGTGGGAGG - Intergenic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1104943298 12:132404789-132404811 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1104950467 12:132437609-132437631 CAGGGAGGAGGGAGGGAGAGAGG + Intergenic
1105261863 13:18785612-18785634 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1105264220 13:18802201-18802223 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1105264680 13:18805310-18805332 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1105283045 13:18980687-18980709 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1105805068 13:23947763-23947785 CAGGGTGAAGGGAGGCTGAGGGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106373263 13:29158335-29158357 CGGGGTGGACGGGGGTTGGGGGG - Intronic
1106584143 13:31042867-31042889 GAGGGTGGAAGGAGAGTGGAAGG + Intergenic
1107003913 13:35585147-35585169 CAGAGTGGGCGGAGGCTGGCAGG - Intronic
1107116098 13:36747375-36747397 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1107908337 13:45082576-45082598 CTGGGAGGACAGAGTGTGGGAGG - Intergenic
1108222577 13:48251771-48251793 TAGAGTGGAAGGAGAGTGGGGGG - Intronic
1108391568 13:49952481-49952503 TAGAGTGGAAGGAGGGTGGGAGG + Intergenic
1108546839 13:51503524-51503546 AGGGGGGGAGGGAGGGTGGGGGG - Intergenic
1108813052 13:54253589-54253611 GAGGGTGGAAGGTGGGTGGAAGG + Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1110295240 13:73856516-73856538 TATGGAGGAGGGAGGGTGGGAGG - Intronic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1112653948 13:101428629-101428651 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1113207282 13:107931528-107931550 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1113665283 13:112136786-112136808 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1113674115 13:112196354-112196376 CAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1113780778 13:112975933-112975955 TGGGGTGGAAGGAGGGAGGGAGG - Intronic
1113791562 13:113031568-113031590 CAGGGTGGAGGGAGAATGCGGGG + Intronic
1113820677 13:113209947-113209969 CAGGGCGGAGGGAGAGCGGGCGG - Intronic
1113853926 13:113433717-113433739 AAGTGTGGGCGGGGGGTGGGAGG - Intronic
1113922544 13:113921670-113921692 CAGGGTGGGCGAAGGGCAGGGGG - Intergenic
1114155511 14:20099191-20099213 CGGGGCGGGGGGAGGGTGGGAGG + Intergenic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1114532182 14:23403026-23403048 CAAGGAGGAGGGAGGGTGGCAGG + Intronic
1115351911 14:32404920-32404942 CAGGAGGGAGGGAGGGAGGGTGG + Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116279998 14:42894494-42894516 GAGGGTGGAGGGAGGGTGTGTGG - Intergenic
1116363158 14:44027078-44027100 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1117534479 14:56690523-56690545 CAGGGTGGAAGGAAGCTGAGGGG + Intronic
1117604684 14:57415797-57415819 CAGTTTGGAGGGAGGGAGGGAGG - Exonic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119616663 14:76103311-76103333 CAGGGAGGAGGCTGGGTGGGGGG - Intergenic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1119715185 14:76854050-76854072 CCGGGTGGACTGAGGCTGGAGGG - Intronic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121148535 14:91607849-91607871 AAAGGTGGAGGGAGGGAGGGAGG - Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121439891 14:93941973-93941995 GAGGTTGGACAGAAGGTGGGTGG + Intronic
1121446769 14:93983733-93983755 CTGTGTGGACGGAGGCTGTGTGG - Intergenic
1121622517 14:95360434-95360456 CTGGGAGGACGGGGGCTGGGGGG - Intergenic
1121632583 14:95432019-95432041 CAGGGTGCCTGGAGGGTTGGTGG - Intronic
1121769112 14:96516389-96516411 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1121832729 14:97065999-97066021 GAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1122101116 14:99410251-99410273 CTGTGTGCACGGAGGGTGTGGGG + Intronic
1122538335 14:102481872-102481894 CAGGGTGGAAGTAGGAAGGGAGG - Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122894001 14:104746403-104746425 CAGGGTGCAGGGAGGGTGGCTGG - Intronic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1122996648 14:105268777-105268799 CAGGGTGGAGGTGGGGTGGTGGG + Intronic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1202902007 14_GL000194v1_random:49585-49607 CAGGGTGGAGGGAGGCTGAGGGG + Intergenic
1123814007 15:23958093-23958115 CAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1124172381 15:27387856-27387878 AAGGGAGGAAGGAGGGAGGGAGG + Intronic
1124278282 15:28344001-28344023 CAGGGGGGACCCAGGATGGGTGG - Intergenic
1124304420 15:28567607-28567629 CAGGGGGGACCCAGGATGGGTGG + Intergenic
1124396138 15:29303636-29303658 CAGGGTGGAGGGTGGGGGAGGGG - Intronic
1124439417 15:29675536-29675558 GATGGTGGGCGGGGGGTGGGGGG - Intergenic
1124682088 15:31740426-31740448 GATGGTGGGGGGAGGGTGGGAGG + Intronic
1124883364 15:33662048-33662070 CAGGGTGGGTGGAAGGTTGGAGG - Intronic
1124967656 15:34448443-34448465 CCGGGTGGAGGGAGGCAGGGCGG + Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125201281 15:37102142-37102164 CGGGGAGGAGGGCGGGTGGGAGG + Intergenic
1125331648 15:38588501-38588523 CAGGGGGGCCGGTGGGTGGAGGG - Intergenic
1125463977 15:39933376-39933398 GTGGGAGGAAGGAGGGTGGGGGG + Intergenic
1125529170 15:40400568-40400590 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1125874716 15:43133823-43133845 CAGGGTGGTCGCGGGGTTGGCGG + Exonic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126322620 15:47441840-47441862 CAGGATGGATGGAGTGTGAGTGG + Intronic
1128249795 15:66156135-66156157 CAGGTTGGAAGGAGGGTCAGAGG + Intronic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128929688 15:71693109-71693131 CAGGATGTGGGGAGGGTGGGGGG + Intronic
1128967769 15:72077626-72077648 CAGGGTGGTGGCAGGGTGGCGGG + Intronic
1129002816 15:72348023-72348045 GAGGAAGGAAGGAGGGTGGGTGG - Intronic
1129149658 15:73680160-73680182 CAGAGTGGAGTGCGGGTGGGTGG + Intergenic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129849521 15:78784404-78784426 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1130000502 15:80042292-80042314 CAGGAAGGAAGGAGGGAGGGAGG - Intergenic
1130040196 15:80399977-80399999 AAGGAAGGAAGGAGGGTGGGAGG - Intronic
1130055883 15:80525544-80525566 GAGGATGGAAGGAGGGAGGGAGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1130553860 15:84909335-84909357 AAGGATGGATGGAGGCTGGGAGG - Intronic
1130797866 15:87229934-87229956 TGGGGTGGGGGGAGGGTGGGAGG - Intergenic
1131306538 15:91248894-91248916 TAGGGTGGACTCAGGGTGTGGGG + Intronic
1131393182 15:92066050-92066072 CAGGAAGGATGGAGGGTGGCTGG - Intronic
1131526773 15:93159018-93159040 GAGGATGGAAGAAGGGTGGGGGG - Intergenic
1131527684 15:93165751-93165773 GAGGGGGGGCGGGGGGTGGGAGG - Intergenic
1131885545 15:96907998-96908020 CAGGATGGGCGGGGGGAGGGGGG + Intergenic
1132231080 15:100184731-100184753 CATGATGGACGGAGGGAAGGTGG - Intronic
1132568069 16:632198-632220 CCGGATGGAAGGAGGGTGGGAGG - Intronic
1132571332 16:645673-645695 CAGGGCAGATGGAGGGTGTGGGG + Intronic
1132572744 16:651134-651156 CTCGGTGGTGGGAGGGTGGGTGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132614328 16:832744-832766 CAGGGTGGACGGGGCGGGGCGGG - Intergenic
1132644690 16:993546-993568 GTGGGTGGATGGAGGATGGGAGG - Intergenic
1132650801 16:1020708-1020730 GAGGGTGGAGGGAGGGCAGGCGG + Intergenic
1132664613 16:1075915-1075937 CAGGGTGGGGGGAGAGAGGGAGG - Intergenic
1132666822 16:1084785-1084807 GAGGGTGGCCGGAGAGTGAGGGG + Intergenic
1132669753 16:1097763-1097785 CAGGGTGGAGGGAGGCTGAGGGG + Intergenic
1132715848 16:1289448-1289470 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1132781052 16:1625897-1625919 CAGGGTAGAGGGCCGGTGGGAGG - Intronic
1132846232 16:2002084-2002106 CAGCCTGGCCGGAGGGTGGGAGG + Intronic
1132994274 16:2814992-2815014 CATGGCAGATGGAGGGTGGGAGG - Intergenic
1132996752 16:2827434-2827456 CATGGCAGATGGAGGGTGGGAGG + Intergenic
1133025354 16:2986827-2986849 CAGGCAGGACGGTGGGGGGGCGG + Intergenic
1133985190 16:10663039-10663061 CAGGGTTGAGGGTGAGTGGGTGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134136065 16:11677145-11677167 CGGGGTGGAGGGTTGGTGGGGGG - Exonic
1134224423 16:12380445-12380467 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224428 16:12380460-12380482 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224468 16:12380582-12380604 ATGGGTGGATGGATGGTGGGTGG - Intronic
1134224488 16:12380643-12380665 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224519 16:12380743-12380765 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224596 16:12380993-12381015 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224601 16:12381008-12381030 GTGGGTGGATGGTGGGTGGGTGG - Intronic
1134224609 16:12381027-12381049 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224627 16:12381084-12381106 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224636 16:12381107-12381129 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224659 16:12381172-12381194 GTGGGTGGATGGTGGGTGGGTGG - Intronic
1134519284 16:14911414-14911436 CAGGGCGGACGGGGCGAGGGGGG - Intronic
1134706954 16:16310069-16310091 CAGGGCGGACGGGGCGAGGGGGG - Intergenic
1134881341 16:17747412-17747434 AAGGAAGGACGGATGGTGGGAGG + Intergenic
1134960586 16:18402055-18402077 CAGGGCGGACGGGGCGAGGGGGG + Intergenic
1135051759 16:19198972-19198994 CTGAGTGGTCGGTGGGTGGGTGG + Intronic
1135927702 16:26709857-26709879 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1135993726 16:27232799-27232821 CTGGGTGAACGGGGAGTGGGAGG + Intronic
1135995107 16:27241692-27241714 CCGGGTGGAAGGAGAGTGGCTGG + Intronic
1136023011 16:27451778-27451800 GAGGGTGGATGGAGGATGGATGG + Exonic
1136268021 16:29132155-29132177 GAGGGAGGATGGAGGGAGGGAGG + Intergenic
1136295225 16:29297800-29297822 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1136365067 16:29806125-29806147 CATGGCGGAGGGAGGGAGGGAGG - Intronic
1136663294 16:31784231-31784253 GAGGGTGGAAGGAGGGTGAGGGG - Intronic
1137495041 16:48963028-48963050 CAGGGAGGAAGGAAGGAGGGAGG + Intergenic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1137673216 16:50291345-50291367 GGGGGTGGAGGGAGGGCGGGTGG + Intronic
1137788359 16:51154653-51154675 CTGGGTGGAGGTGGGGTGGGGGG + Intergenic
1137808251 16:51328483-51328505 CAGGGGAGATGGTGGGTGGGGGG - Intergenic
1138045818 16:53723745-53723767 CATGGTGGAAGGAGGGAGAGTGG + Intronic
1138170553 16:54845227-54845249 CAAGGAGGAGGGAGGATGGGTGG + Intergenic
1138392849 16:56682853-56682875 CAGGGTGGATGGGAAGTGGGGGG + Intronic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1138546293 16:57721879-57721901 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
1138619715 16:58201319-58201341 GAAGGTGCACGGAGGGTGGGTGG - Intergenic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1139088537 16:63617438-63617460 CCGGGTGGGCGCAGGCTGGGCGG - Intergenic
1139375054 16:66491641-66491663 CAGGGTGGAGGGATGGGGGCGGG + Intronic
1139375745 16:66495371-66495393 CAGGGTGGGAGGGAGGTGGGAGG - Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1139725197 16:68891920-68891942 CAGGGAGGAGGGAGGGAGAGAGG + Intronic
1139982690 16:70872618-70872640 GAGGGTGGATGGATGATGGGTGG - Intronic
1140067724 16:71625503-71625525 ATGGATGGATGGAGGGTGGGTGG + Intergenic
1140200248 16:72889053-72889075 ATGGGTGGAGGGAGGGAGGGAGG + Intronic
1140257511 16:73349747-73349769 GAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1140332447 16:74070890-74070912 GAGCGTTGAGGGAGGGTGGGTGG + Intergenic
1140372035 16:74419232-74419254 CAGAGTGGATGCAGGGAGGGGGG + Intronic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814074 16:78604789-78604811 GAGGGAGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1140884856 16:79234085-79234107 CAGGAAGGTTGGAGGGTGGGCGG - Intergenic
1141029463 16:80575042-80575064 CAAGGGAGACTGAGGGTGGGGGG + Intergenic
1141110073 16:81265208-81265230 ATGGGTGGACGGATGGTGGATGG - Intronic
1141110196 16:81265678-81265700 GATGGTGGATGGATGGTGGGTGG - Intronic
1141173384 16:81704569-81704591 CAGGGAGGAGGGTGAGTGGGTGG - Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141483827 16:84325571-84325593 GTGGGTGGATGGATGGTGGGTGG - Intronic
1141517847 16:84558386-84558408 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1141605871 16:85152878-85152900 CAGGGAGGAGGGGGGGTAGGGGG + Intergenic
1141675129 16:85513777-85513799 CAGTGTGCACCGGGGGTGGGGGG - Intergenic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1142022400 16:87791848-87791870 CGGGGTGGGCGGGGGGGGGGGGG + Intergenic
1142095607 16:88237798-88237820 CAGAGTGCAGGGAGGGTGAGTGG - Intergenic
1142101126 16:88271811-88271833 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1142110331 16:88327689-88327711 GAGTGTGCACGGAAGGTGGGAGG - Intergenic
1142198683 16:88750859-88750881 GAGGGTGGGTGGAGGGTGGAGGG - Intronic
1142255670 16:89012602-89012624 ATGGGTGGATGGATGGTGGGTGG - Intergenic
1142289717 16:89187992-89188014 GAGGCAGGAGGGAGGGTGGGAGG + Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1142492478 17:287945-287967 GACGGTGGAGAGAGGGTGGGAGG - Intronic
1142547390 17:714522-714544 GCGGGTGGACGGAGGGCCGGGGG - Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1142836876 17:2593903-2593925 GAGGGAGGAAGGAGGGAGGGAGG - Exonic
1142994580 17:3753144-3753166 CAGGCTGGATGGCGGCTGGGCGG - Intronic
1143096388 17:4480678-4480700 AAGGGTGGAAGGAGGGTTAGGGG + Intronic
1143116974 17:4586675-4586697 CGGGGTGGATGGAAGGTGGAGGG + Intronic
1143202430 17:5122125-5122147 CGGGGTGGAGGGTGGGTCGGTGG + Intronic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143673726 17:8415107-8415129 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1143769148 17:9156957-9156979 GTGGGTGGAGGGAGGGAGGGAGG - Intronic
1144512988 17:15893494-15893516 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1144626942 17:16848805-16848827 CGGGGTGGAGGCTGGGTGGGGGG - Intergenic
1144727036 17:17507207-17507229 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1144829046 17:18121600-18121622 GAGGGTGGGCGTTGGGTGGGAGG - Exonic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1144879497 17:18423907-18423929 CGGGGTGGAGGCTGGGTGGGGGG + Intergenic
1144966093 17:19078079-19078101 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144981875 17:19174110-19174132 CTGGGTGGATGGGGAGTGGGTGG - Intergenic
1144986348 17:19204129-19204151 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1145152743 17:20520480-20520502 CGGGGTGGAGGCTGGGTGGGGGG - Intergenic
1145235095 17:21202560-21202582 CAGGGGGGCCGGAGGGGGTGAGG - Intronic
1145240195 17:21236457-21236479 GTGGGTGGATGGTGGGTGGGTGG - Intergenic
1145790288 17:27622358-27622380 CGGGGCGGGCGGAGGTTGGGAGG + Exonic
1145794650 17:27648740-27648762 GAGGAGGGAGGGAGGGTGGGAGG + Intronic
1146197229 17:30824306-30824328 GGGGGTGGAGGGAGGGTGTGAGG - Intronic
1146240707 17:31221092-31221114 GGGGGTGGAGGGATGGTGGGAGG + Intronic
1146283790 17:31560940-31560962 CTGGGAGGAGGGAGGGTGAGAGG + Intergenic
1146307836 17:31744146-31744168 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1146504723 17:33394998-33395020 GATGGTGGAGGGAGGGAGGGAGG - Intronic
1146518639 17:33509171-33509193 AAGGTAGGACGGAGGGAGGGCGG + Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146688315 17:34856580-34856602 GGGGGAGGACGGAGGGTGGGAGG + Intergenic
1146688409 17:34856863-34856885 TGGGGAGGATGGAGGGTGGGAGG + Intergenic
1146688492 17:34857149-34857171 GAAGGTGGATGGAGGGTGGAAGG + Intergenic
1146925030 17:36738563-36738585 CAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1147184363 17:38705552-38705574 CAGGGGGGAGGGAGGGAGCGGGG - Exonic
1147389968 17:40103178-40103200 GAGGGTGGAGGGAGAGGGGGTGG - Intergenic
1147436838 17:40421572-40421594 CAGAGTGGGGGCAGGGTGGGTGG - Intergenic
1147458124 17:40551439-40551461 CAGGGTTGCAGGAGGGTGTGGGG - Intergenic
1147523244 17:41195113-41195135 AAGGGTGGAGGGTGGGAGGGGGG + Intronic
1147657432 17:42098663-42098685 CAGGGGGTGCGGGGGGTGGGTGG + Intergenic
1147818829 17:43229622-43229644 GAGGGTGGATGGATGCTGGGAGG + Intergenic
1147832112 17:43304324-43304346 GAGGGTGGATGGATGCTGGGAGG + Intergenic
1147868944 17:43573773-43573795 CAGGGTGGGTGGGGGCTGGGAGG + Intronic
1147877669 17:43632847-43632869 CAGGATGAAGGGAGGGTGGACGG + Intergenic
1147879342 17:43643877-43643899 TGGGGTGGGGGGAGGGTGGGAGG - Intronic
1148038765 17:44689660-44689682 CTGGCTGGACGGACGGTTGGAGG - Exonic
1148240058 17:45994376-45994398 CAGGGAGGCAGGAGGATGGGAGG + Intronic
1148787167 17:50151021-50151043 CGGGGGGGAGGGAGGGAGGGAGG - Intergenic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1148806383 17:50266151-50266173 CAGGGAGGACGGAGAGTGGGAGG - Intergenic
1148860700 17:50602942-50602964 CAGCTTGGGCTGAGGGTGGGAGG + Intronic
1149613007 17:57971397-57971419 CAGGCTGGTTGGAGGGTGGAAGG - Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149681281 17:58508966-58508988 CAGTGGGGACCCAGGGTGGGGGG + Intronic
1150129882 17:62663239-62663261 TAGGGAGGAAGGAGGGAGGGAGG - Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150269046 17:63850534-63850556 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1150859429 17:68786265-68786287 GAGGGAGGAAGGAAGGTGGGAGG - Intergenic
1151152132 17:72097301-72097323 GAAGGTGGACGGAGGGTGGCCGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151354835 17:73552070-73552092 CAGGCTGGCCGAGGGGTGGGGGG - Intronic
1151599490 17:75097532-75097554 GAAGGTGGTGGGAGGGTGGGAGG + Intronic
1151713903 17:75821819-75821841 CTGGGTTGGCGGTGGGTGGGAGG + Intronic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1151822244 17:76502517-76502539 CAGGCTGGAAGGAGGGGGAGTGG + Intergenic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151957927 17:77389684-77389706 CACCAGGGACGGAGGGTGGGCGG + Intronic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152539126 17:80966121-80966143 CAGGGTGGAGCGGGGGCGGGGGG - Exonic
1152574319 17:81133476-81133498 CAGGGAGGGAGGAGGGTGGGAGG - Intronic
1152592959 17:81222715-81222737 CAGGGCGCACGGAGGTTGGAGGG - Intronic
1152613433 17:81327147-81327169 GCGGGGGGGCGGAGGGTGGGAGG - Intronic
1152635349 17:81428576-81428598 CAGGGTGGGTGGAGGGAGTGGGG - Intronic
1152821353 17:82439341-82439363 CTGGGTGGACCTTGGGTGGGTGG - Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153815335 18:8785838-8785860 AAGGGTGGAGGCAGGGAGGGGGG - Intronic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1153914568 18:9734097-9734119 CGGGGAGGAGGGAGGGAGGGAGG + Intronic
1154022492 18:10676698-10676720 CCAGGTGGACAGAGAGTGGGAGG + Intronic
1154092237 18:11376323-11376345 CAGGATGGAGGGAGTGTGGTAGG + Intergenic
1154216671 18:12420793-12420815 CGGGGTGGGGGGACGGTGGGGGG + Intronic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1154413147 18:14153794-14153816 GGGGGTGGAGGGGGGGTGGGAGG - Intergenic
1154423716 18:14256251-14256273 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1154424181 18:14259360-14259382 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1154426852 18:14278562-14278584 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1154428203 18:14288338-14288360 TAGGGTGGTGGGAGGGTGGGGGG + Intergenic
1154429582 18:14298096-14298118 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1154431850 18:14314442-14314464 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1155060077 18:22220600-22220622 GAGGGTGGAGGGTGGGAGGGGGG - Intergenic
1155149057 18:23108073-23108095 GAGAGTAGAGGGAGGGTGGGAGG - Intergenic
1155232231 18:23784677-23784699 AAGGGGGGATGGAAGGTGGGAGG + Intronic
1155459971 18:26067862-26067884 GATGGTGGCCGGATGGTGGGAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155560503 18:27071087-27071109 CAGGGTGGAAGGATAGTGGAAGG - Intronic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1157605613 18:48924211-48924233 GAGGCGGGAGGGAGGGTGGGTGG + Intronic
1157606525 18:48929422-48929444 CAGGGTGGCAGGTGGGTAGGTGG - Intronic
1157846312 18:51007017-51007039 CAGGGCGGGCGGGGGGGGGGGGG - Intronic
1157907386 18:51581679-51581701 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907391 18:51581690-51581712 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907396 18:51581701-51581723 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907401 18:51581712-51581734 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907406 18:51581723-51581745 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1158103747 18:53861284-53861306 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1158103753 18:53861299-53861321 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1158103761 18:53861318-53861340 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1158103796 18:53861409-53861431 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1158103802 18:53861424-53861446 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1159964095 18:74579273-74579295 AAGGATGGAAGGAGGGCGGGAGG - Intronic
1160007055 18:75075438-75075460 TGGGGAGGATGGAGGGTGGGAGG + Intergenic
1160194123 18:76738964-76738986 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194143 18:76739016-76739038 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194160 18:76739056-76739078 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160360927 18:78277639-78277661 GATGGGGGAGGGAGGGTGGGAGG - Intergenic
1160508876 18:79442294-79442316 GAGGGTGGACAGAGGTGGGGAGG - Intronic
1160545019 18:79647327-79647349 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1160545041 18:79647380-79647402 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160776624 19:859545-859567 CGGGGAGGGCGGAGGCTGGGCGG + Intergenic
1160777104 19:861442-861464 CAGGGGGAGCGGGGGGTGGGGGG - Intronic
1160910998 19:1473786-1473808 CAGGGTGGAAGGTGGGGAGGGGG - Exonic
1160960362 19:1718207-1718229 GTGGGTGGATGGTGGGTGGGTGG + Intergenic
1160960385 19:1718271-1718293 GTGGGTGGATGGTGGGTGGGTGG + Intergenic
1161091883 19:2364633-2364655 CTGGGTGGAAGGTGGGTGTGCGG - Intergenic
1161153941 19:2722680-2722702 CAGAGTGGAAGGAGGGCTGGAGG - Intronic
1161273145 19:3401308-3401330 CAGGGAGGACAGACTGTGGGGGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161287337 19:3475623-3475645 GTGGGTGGACGGATGGTAGGTGG + Intronic
1161287682 19:3477318-3477340 GTGGGTGGATGGATGGTGGGTGG + Intronic
1161329357 19:3678870-3678892 CAGGATGGAGGGAGGGATGGCGG + Intronic
1161526569 19:4759750-4759772 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161770848 19:6230027-6230049 CAGGGTGGGCGCAGGGCTGGTGG - Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1161856449 19:6768193-6768215 CAGGTGGGAAGAAGGGTGGGGGG + Intergenic
1162057176 19:8071685-8071707 CAGGGTGCAGGCAGGGTTGGAGG + Intronic
1162085884 19:8248858-8248880 GTGGGTGGATGGATGGTGGGTGG + Intronic
1162104595 19:8362822-8362844 CCGGGTGGTGGGAGGGGGGGGGG - Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162343267 19:10105249-10105271 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1162403004 19:10457422-10457444 CAAGGTGGGCGGGGGGGGGGGGG + Intronic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162767712 19:12930154-12930176 CATGGTGGAGGCATGGTGGGAGG - Intronic
1162818140 19:13208244-13208266 CAGGGAGGAGGGAGGGGAGGAGG + Intronic
1162969059 19:14169415-14169437 CAGCGGGGAAGGGGGGTGGGAGG - Intronic
1163382605 19:16978828-16978850 AAGGGTGGATGGTGGGTGAGTGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163609908 19:18295398-18295420 GACGGTGGACGGATGGTGGATGG - Intergenic
1163675375 19:18653239-18653261 AATGGTGGATGAAGGGTGGGTGG - Intronic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1163721378 19:18899750-18899772 CAGGGTGGGGGCAGGGTGTGGGG + Intronic
1163769247 19:19180686-19180708 CTGGGTTGGCGGAGGCTGGGGGG + Exonic
1164270735 19:23669476-23669498 CACGGTGGTGGGGGGGTGGGGGG + Intronic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441822 19:28284880-28284902 GAGGGTGGAGGGAAGGGGGGTGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164565140 19:29320513-29320535 CAGGGAGGACGGAGAGAGTGAGG + Intergenic
1165119911 19:33552324-33552346 CAGGCTGGAAGGAGGGAGAGGGG - Intergenic
1165144421 19:33722231-33722253 ATGGGTGGATGGAAGGTGGGAGG + Intronic
1165149650 19:33753425-33753447 GTGGGAGGATGGAGGGTGGGTGG - Intronic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166054476 19:40280172-40280194 CAGCGTGGACGCAGGGTCAGCGG + Intronic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167048252 19:47064106-47064128 GAGGGTGGAAGGTGGCTGGGGGG - Intergenic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167311423 19:48739763-48739785 CAGGGTGGATGGACGGGGCGGGG + Intronic
1167422379 19:49411889-49411911 AAGGATGGAAGGAGGGAGGGAGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167503479 19:49859851-49859873 CAGGGTGGGTGGGGGGTGTGAGG + Intronic
1167610762 19:50506786-50506808 GTGGGTGGACGGTGGGTGGGTGG - Intronic
1167610770 19:50506805-50506827 TTGGGTGGACGGTGGGTGGGTGG - Intronic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1168135589 19:54349218-54349240 GAGGGTGGATGGATGGAGGGAGG + Intergenic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168143943 19:54408651-54408673 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1168143955 19:54408674-54408696 AAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1168274443 19:55269387-55269409 GAGGGTGGGTGGAAGGTGGGCGG - Intronic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168488819 19:56790016-56790038 CAGGGTGGCATGAGGGTGGCTGG - Intronic
1168721574 19:58557563-58557585 CAGTGAGGACTGAGGGTTGGTGG - Intronic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925017597 2:543661-543683 CAGGGAGGGGGGAGGGTGGGAGG + Intergenic
925017619 2:543730-543752 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017627 2:543753-543775 CAGGGAGGCAGGAAGGTGGGAGG + Intergenic
925017666 2:543860-543882 CAGGGAGGCGGGAAGGTGGGAGG + Intergenic
925017690 2:543929-543951 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017704 2:543967-543989 CAGGGAGGCAGGAGGGTGGGAGG + Intergenic
925118370 2:1398863-1398885 CAGGACTGACAGAGGGTGGGGGG + Intronic
925141319 2:1551434-1551456 CACGGAGGGCGGTGGGTGGGGGG - Intergenic
925171016 2:1750565-1750587 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171031 2:1750592-1750614 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925171048 2:1750623-1750645 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
925344833 2:3163818-3163840 CAGGGAGGTGGGAGGATGGGTGG + Intergenic
925610490 2:5697138-5697160 CTGGGAGGAGGGAGGCTGGGAGG + Exonic
925658874 2:6181440-6181462 AAGGAAGGACGGAGGGAGGGAGG - Intergenic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
925720628 2:6822968-6822990 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
926059244 2:9794895-9794917 GAGGGTGGAGGGAGGGAGGGAGG - Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926269474 2:11354345-11354367 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
926623968 2:15074383-15074405 AAGGATGGAAGGAGGGGGGGAGG + Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926783610 2:16498545-16498567 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
927132837 2:20074982-20075004 CAGGATGGAGGCAGGGTGGCTGG - Intergenic
927201764 2:20582636-20582658 CCGAGTGGAAAGAGGGTGGGTGG - Intronic
927876033 2:26655772-26655794 CAGGGTGGAGGGGGTGTGGGCGG - Intergenic
927945731 2:27134211-27134233 CAGGGTGGCCGGGGGGTCGCGGG - Intronic
928174469 2:29024461-29024483 AAGGGTGCAGGGAGGGAGGGAGG + Intronic
928373744 2:30759055-30759077 GAGGGAGGAGGGAGGGAGGGAGG - Intronic
928408682 2:31035858-31035880 TAGGGTGGATGGTGGGAGGGGGG + Intronic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930335373 2:50038799-50038821 AAGGGAGGAGGGAGGGAGGGAGG - Intronic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
930610885 2:53542100-53542122 CAGGGTTGGGGGAGGTTGGGAGG - Intronic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
930873306 2:56187957-56187979 CAGGGTGGTGGGCGGGTCGGTGG - Intronic
931401241 2:61933371-61933393 CAGGGTGGCAGGGGTGTGGGGGG + Intronic
931808298 2:65829491-65829513 CAGGTAGGAAGGAGGGAGGGAGG - Intergenic
931934935 2:67186458-67186480 CAGGGTGGGAGAAGGGTTGGGGG + Intergenic
932411589 2:71550963-71550985 CAGGTTGGAAGGTGGCTGGGTGG + Intronic
932918293 2:75879918-75879940 GAGGGTGGAAGGGGGGTAGGAGG + Intergenic
933109476 2:78379176-78379198 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
934112446 2:88756332-88756354 CAGGGAGGAGGCAGGGTGGTGGG - Intergenic
934304574 2:91810360-91810382 CACGGTGGGCGGGGGGGGGGGGG - Intergenic
934328683 2:92042390-92042412 CACGGTGGGCGGGGGGGGGGGGG + Intergenic
934492610 2:94771937-94771959 TAGGGTGGTGGGAGGGTGGGTGG - Intergenic
934494362 2:94784465-94784487 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
934504687 2:94880846-94880868 CAGGGTGGAGGGAGGCTGAGGGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934791593 2:97067023-97067045 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
935620519 2:105125883-105125905 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
935626246 2:105174484-105174506 CATGGTGGATGGGGGCTGGGAGG + Intergenic
935686717 2:105690090-105690112 TTGGGTGGATGGGGGGTGGGTGG + Intergenic
935706496 2:105861916-105861938 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
936163661 2:110102793-110102815 CAGGGAGGAGGCAGGGTGGTGGG - Intronic
936295021 2:111261378-111261400 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
936507093 2:113116487-113116509 CAGGCGGGGCGGGGGGTGGGGGG + Intronic
936917517 2:117655049-117655071 TAGGGTGGGGGGAGGGTGGAGGG + Intergenic
937225919 2:120368585-120368607 GAGGGTGGAGGGAGGCTGGAGGG + Intergenic
937280197 2:120712545-120712567 GAGGGTGGAGTGATGGTGGGAGG - Intergenic
937291840 2:120786461-120786483 CAGGTTGGGCGGGGGGTTGGAGG - Intronic
937430232 2:121832042-121832064 CAGGCTCCACGGAGAGTGGGTGG + Intergenic
937906474 2:127055175-127055197 CATGGTGGAGGCCGGGTGGGAGG - Intronic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
938138456 2:128777590-128777612 CAGAAGGGACGGAGGGAGGGAGG - Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
939197713 2:138992620-138992642 GAGGGTGGATGGAGGCTGGAAGG + Intergenic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
941170033 2:162125265-162125287 CAGGGAGGAGGGAGGGGGGCTGG - Intergenic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941306044 2:163868571-163868593 TATGGAGGATGGAGGGTGGGAGG + Intergenic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
942414213 2:175741285-175741307 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
943702736 2:191004135-191004157 CAGGGTGGAGGGAAGCAGGGAGG - Intronic
944163030 2:196686756-196686778 GAGGGTGGAGGGTGGGTGGAGGG - Intronic
944429914 2:199622050-199622072 CAGGGTGGGAGGAGGCTGGCAGG + Intergenic
944677909 2:202049433-202049455 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
945203727 2:207310213-207310235 CGGGGTGGAGGGCGGGTGGGAGG + Intergenic
945216300 2:207437552-207437574 GAGAGTGAACGGAGGGCGGGAGG + Intergenic
945225785 2:207530174-207530196 CCGGGGGGACGGAGGGGGGACGG + Intronic
945541897 2:211098269-211098291 GTGGGTGGAGGGAGGGAGGGAGG - Intergenic
945546878 2:211165740-211165762 CAGGATGGAAGGAGGGAGGGAGG + Intergenic
945608968 2:211974080-211974102 GAGGGTGGACGGTGGGAGGAGGG + Intronic
945838849 2:214864818-214864840 AAGGGTAGTTGGAGGGTGGGGGG + Intergenic
945876124 2:215279865-215279887 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
946106520 2:217375071-217375093 TAAGGTGGATGGAGGGAGGGAGG + Intronic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946308627 2:218870898-218870920 CAGTTTGGAGGTAGGGTGGGAGG + Intronic
946412733 2:219523066-219523088 CGGCGGGGACGGTGGGTGGGTGG - Intronic
947448019 2:230179488-230179510 CAGGGAGGAGTGGGGGTGGGAGG + Intronic
947643390 2:231720450-231720472 CAGAGCTGACGGAGGGCGGGAGG - Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948574907 2:238943732-238943754 CAGGGAGGGCGGAGGGAGAGGGG - Intergenic
948654999 2:239471080-239471102 CAGGAGGGCAGGAGGGTGGGTGG - Intergenic
948880096 2:240852300-240852322 CAGGGTGGCCAAAGGGTGTGTGG - Intergenic
949033842 2:241807644-241807666 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949033958 2:241807925-241807947 GAGGGGGGAGGGAGGGAGGGTGG - Intergenic
949034023 2:241808089-241808111 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1168857623 20:1019821-1019843 GAGGGTGGATGGTGGATGGGAGG - Intergenic
1168857627 20:1019832-1019854 GAGGGTGGGTGGAGGGTGGATGG - Intergenic
1168857655 20:1019941-1019963 GAGGGTGGATGGTGGATGGGAGG - Intergenic
1169009843 20:2241360-2241382 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1169346510 20:4832800-4832822 GAGGGTGGAGGGTGGGAGGGAGG + Intergenic
1169367170 20:5001212-5001234 CAGGGTGGCCGGCGGGCGCGGGG + Intronic
1169385510 20:5145911-5145933 GAGGGTTGACTGAGTGTGGGAGG - Intronic
1169557921 20:6768898-6768920 CGGGGTGGGTGGTGGGTGGGAGG + Intronic
1170098688 20:12675026-12675048 AAGTGTGGACAGAGGCTGGGTGG - Intergenic
1170369677 20:15635585-15635607 GAGGGTGGGTGGAGGGAGGGAGG + Intronic
1171370929 20:24661504-24661526 GAGGGAGGAAGGAGGGAGGGAGG + Intronic
1171883683 20:30636178-30636200 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1172114020 20:32563161-32563183 GAGGGTGGAGGGAGGGAGAGTGG + Intronic
1172271779 20:33659256-33659278 CAGTGTGGACGGAAGCTGGAGGG - Intronic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1172969264 20:38861589-38861611 CAGGCTGGCTGAAGGGTGGGGGG - Intronic
1173431080 20:42987625-42987647 AGGGGTGGGCGGAGTGTGGGCGG - Intronic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1173530945 20:43769187-43769209 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1173843202 20:46172472-46172494 CAGGGTGGAGGAGTGGTGGGAGG - Intergenic
1174404691 20:50295785-50295807 CAGGGTGCAGGGAGCGTGAGGGG - Intergenic
1174455892 20:50648514-50648536 CAGGGTGGGGGTTGGGTGGGTGG + Intronic
1174469345 20:50744636-50744658 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1174485387 20:50857857-50857879 CATGGTGGGGTGAGGGTGGGCGG + Intronic
1174763508 20:53229779-53229801 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174804495 20:53593869-53593891 CGGGGAGGGCGGAGGGAGGGAGG + Intronic
1174804497 20:53593873-53593895 GAGGGCGGAGGGAGGGAGGGAGG + Intronic
1174824111 20:53753849-53753871 CAGGGTGGGGCGGGGGTGGGGGG - Intergenic
1174835626 20:53853640-53853662 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1175173099 20:57093335-57093357 GAGGCTGGTGGGAGGGTGGGTGG + Intergenic
1175273891 20:57754442-57754464 CAGGAAGGAGGGAGGGAGGGAGG - Intergenic
1175288041 20:57850923-57850945 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
1175313961 20:58032936-58032958 CGGGGTGGGTGGAGGGTTGGGGG + Intergenic
1175388509 20:58612146-58612168 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1175597900 20:60250111-60250133 CACGGGGGAGGGAGTGTGGGTGG - Intergenic
1175717134 20:61262755-61262777 GAAGGAGGAAGGAGGGTGGGAGG - Intronic
1175766861 20:61598261-61598283 CAGGCAGGCCGGTGGGTGGGAGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175889368 20:62309587-62309609 GAGGGTGGTAGGGGGGTGGGAGG + Intronic
1175889373 20:62309598-62309620 GGGGGTGGGAGGAGGGTGGGAGG + Intronic
1175934697 20:62509463-62509485 GAGGGTGGAGGGATGGTGGCTGG - Intergenic
1175983959 20:62755113-62755135 AAGGATGGATGGAGGGAGGGAGG - Intronic
1175984067 20:62755461-62755483 GAGGATGGATGGAGGGAGGGAGG - Intronic
1175984137 20:62755663-62755685 GAGGATGGATGGAGGGAGGGAGG - Intronic
1175984197 20:62755834-62755856 GAGGATGGATGGAGGGAGGGAGG - Intronic
1176057887 20:63158396-63158418 AATGGTGGATGGATGGTGGGTGG + Intergenic
1176057937 20:63158562-63158584 GATGGTGGATGGATGGTGGGTGG + Intergenic
1176275339 20:64262934-64262956 CAGGGTGGCCGGGGGGTGTCAGG - Intronic
1176388224 21:6150359-6150381 CAGGGAGGAGGAAGGGAGGGAGG + Intergenic
1176621376 21:9064352-9064374 CAGGGTGGAGGGAGGCTGAGGGG + Intergenic
1176733486 21:10521905-10521927 GAGGGCGGAGGGAGGGAGGGAGG - Intronic
1176733488 21:10521909-10521931 CGGGGAGGGCGGAGGGAGGGAGG - Intronic
1176843871 21:13861763-13861785 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1176845185 21:13871320-13871342 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1176846556 21:13881084-13881106 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1176847916 21:13890877-13890899 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1176849756 21:13903757-13903779 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1176860798 21:14010737-14010759 AAGGAGGGACGGAGGGAGGGAGG - Intergenic
1177588350 21:23128622-23128644 CAGCCTGGAAGGAGGGAGGGAGG - Intergenic
1177797232 21:25791851-25791873 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1178252164 21:31013862-31013884 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1178361038 21:31948647-31948669 AAGGAAGGACGGAGGGAGGGAGG + Intronic
1178465713 21:32845892-32845914 CAGGGTGAACGAATGGTGAGCGG + Intergenic
1178516080 21:33248375-33248397 TAGGGGGGAGGGAGGGAGGGGGG + Intronic
1178695059 21:34785760-34785782 GAGGGTGGGTGGAGTGTGGGTGG + Intergenic
1178924335 21:36762365-36762387 GTGGGTGGAGGGAGGGTGCGGGG + Intronic
1179014745 21:37586972-37586994 AAGGGTGGAGGGTGGGAGGGAGG - Intergenic
1179244729 21:39623071-39623093 AAGGATGGAGGGAGGGAGGGAGG - Intronic
1179644988 21:42770287-42770309 CAGGAAGGTCGGAGGGTGTGAGG - Intronic
1179732578 21:43375879-43375901 TAAGGTGGACGGTCGGTGGGCGG - Intergenic
1179735248 21:43387889-43387911 CAGGGAGGAGGAAGGGAGGGAGG - Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179928111 21:44549796-44549818 CTGGGTGGGCGGAGGGCCGGTGG - Intronic
1179958209 21:44752644-44752666 CAGGAAGGAAGGAGAGTGGGAGG + Intergenic
1179986966 21:44927515-44927537 CAGGCAGGTTGGAGGGTGGGCGG - Intronic
1180182475 21:46124163-46124185 GTGGGTGGACAGAGGATGGGTGG + Intronic
1180713426 22:17855525-17855547 CAGGGCGGACGGATGGAGGAAGG + Intronic
1181099855 22:20531880-20531902 CTGGGTGGAAGCAGGGTGGGAGG + Intronic
1181116513 22:20635344-20635366 CAGGCTGGCCGGAGCCTGGGTGG - Intergenic
1181237661 22:21457453-21457475 CAGGCTGGAGGAAGGGTGTGAGG + Intergenic
1181268407 22:21644188-21644210 ATGGGTGGATGGAGGGTGGCAGG + Exonic
1181513722 22:23400176-23400198 CAGGGTGCAGGTAGGGTGAGTGG + Intergenic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181534388 22:23534121-23534143 CAGGGAGGAAGAAGGGAGGGAGG + Intergenic
1181639647 22:24189868-24189890 CTGGGTGGCAGGAGGTTGGGAGG + Intergenic
1181917401 22:26292177-26292199 AAGGAAGGAGGGAGGGTGGGAGG + Intronic
1182664271 22:31945407-31945429 GAGAGTGGGCGGAGGGTGTGGGG + Intronic
1182709194 22:32310065-32310087 GAGGGAGGACGGGGGATGGGGGG + Intergenic
1182716884 22:32364092-32364114 CAGGGTGAAGGGAGTGGGGGAGG - Intronic
1183069106 22:35383962-35383984 CAGGTTGAACAGAGGGTGTGGGG + Intronic
1183264936 22:36819202-36819224 CACGGGGGGCGGTGGGTGGGGGG + Intronic
1183302176 22:37063807-37063829 CAGGGTGGGTGGAGGGTCTGGGG - Intergenic
1183373821 22:37450689-37450711 CGGGGAGGAAGGAGGGCGGGTGG - Intergenic
1183375652 22:37463405-37463427 CAGGGTAGACGTGGGGAGGGAGG + Intergenic
1183535520 22:38398551-38398573 CGGGGAGGGCGGAGGGAGGGAGG + Intergenic
1183560733 22:38570444-38570466 CTGGGATGACGGAGGGAGGGAGG + Intergenic
1183617481 22:38954422-38954444 CGGGGGGGACAAAGGGTGGGGGG - Intronic
1183667349 22:39253521-39253543 CAGGGAGGACGGGGTGGGGGTGG - Intergenic
1183672839 22:39283281-39283303 CAGGCTGGATGGAGTGGGGGTGG - Intergenic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184046975 22:41977689-41977711 CAGGGTGGAAGGAAGAGGGGGGG + Intronic
1184110005 22:42389012-42389034 CTGGGTGGGTGGAGGGTTGGGGG - Intronic
1184151702 22:42643441-42643463 CAGGGTGGGGGGTGGGGGGGCGG - Intronic
1184173635 22:42773464-42773486 CAGGAAGCACGGAGGTTGGGGGG + Intergenic
1184236742 22:43187113-43187135 CAGGGCCGACGGACGGCGGGCGG - Exonic
1184293244 22:43509158-43509180 GATGATGGACGGAGGGAGGGAGG - Intergenic
1184513521 22:44946514-44946536 AAGGGTGGACGGATGGTGGGTGG + Intronic
1184607381 22:45581883-45581905 CAGGGTGCAGGGAGGGTCGAGGG + Intronic
1184852308 22:47127982-47128004 TGGGGTGGAGGGAGGATGGGGGG - Intronic
1184852322 22:47128010-47128032 TGGGGTGGAGGGAGGATGGGGGG - Intronic
1184878109 22:47288346-47288368 GTGGGTGGATGGAGGGAGGGAGG - Intergenic
1185053573 22:48566353-48566375 ATGGGTGGACGGATGGTGGATGG + Intronic
1185063739 22:48620639-48620661 GATGGTGGATGGTGGGTGGGTGG - Intronic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185179534 22:49351125-49351147 CAGGGCTGGCGGAGGGTGGGAGG + Intergenic
1185197024 22:49477726-49477748 GATGGTGGATGGATGGTGGGTGG + Intronic
1185224570 22:49645194-49645216 ATGGGTGGATGGTGGGTGGGTGG + Intronic
1185270240 22:49926612-49926634 AAGAGGGGACCGAGGGTGGGGGG - Intronic
1185270367 22:49926859-49926881 AAGAGGGGACCGAGGGTGGGGGG - Intronic
1185288740 22:50013844-50013866 CGGGGTGGTGGGAGGGAGGGAGG - Intergenic
1185335831 22:50270455-50270477 CTGGGTGGCCGGGGCGTGGGGGG + Intronic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949950391 3:9224388-9224410 CAGGGTGGAGGAGGGGTGCGTGG - Intronic
950043946 3:9937980-9938002 CAGGGTGGAGGGAGGTGGGGAGG - Intronic
950327172 3:12121699-12121721 CAGGGAGGAGGGAGGAAGGGAGG + Intronic
950483736 3:13260754-13260776 CAGGGTGCACGGGGCGTGGAAGG + Intergenic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
953905427 3:46866108-46866130 GGGGGTGGAGGGAGGGAGGGTGG + Intronic
954230983 3:49217474-49217496 CAGGCTGGTTGGGGGGTGGGGGG + Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955479854 3:59378601-59378623 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955758272 3:62249396-62249418 CAGGGTGGAGGGAAGGGGGTGGG + Intronic
955855139 3:63264804-63264826 CAGGGTGGAAGGACGGAGTGAGG + Intronic
956299470 3:67754522-67754544 CGGGGTGGTGGGAGGGTGTGTGG + Intergenic
956835439 3:73092651-73092673 CAGGAAGGAGGGAGGGAGGGAGG - Intergenic
958198646 3:90278756-90278778 TGGGGTGGGCGGAGGGTGGAGGG - Intergenic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
961394628 3:126578403-126578425 CAGGGTGGGAGGGGAGTGGGGGG + Intronic
961521504 3:127469763-127469785 CAGGGTGGAGGCAGGGTGTGGGG - Intergenic
961649279 3:128409486-128409508 CAAGGTTGACGAAGGGTGGCTGG - Intergenic
961660952 3:128468604-128468626 CAGGGTGGCCGGGGGTGGGGTGG - Intergenic
961861440 3:129919415-129919437 AGGGAGGGACGGAGGGTGGGAGG + Intergenic
961958123 3:130825385-130825407 CAGGGAGGAGGGAGGGAGGGAGG + Intergenic
962397020 3:135025102-135025124 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
963042244 3:141078384-141078406 CTGGCTGGAAGGAGGGTGTGGGG + Intronic
963108256 3:141664681-141664703 CTGGGTGGAAGGAGGCTTGGGGG - Intergenic
963196963 3:142543379-142543401 AGGGATGGACGGAGGGAGGGAGG - Intronic
963196976 3:142543418-142543440 AAGGACGGACGGAGGGAGGGAGG - Intronic
963532070 3:146483271-146483293 CGTGGTGAACGGGGGGTGGGGGG + Intronic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
964780221 3:160328993-160329015 GAGGGTGGAGGGTGGGAGGGAGG + Intronic
964791250 3:160454294-160454316 CTGCTTGGGCGGAGGGTGGGGGG + Intronic
965186899 3:165476510-165476532 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
965186951 3:165476676-165476698 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966468709 3:180262764-180262786 AAGGGTAGAAGGAGTGTGGGGGG + Intergenic
966529403 3:180958385-180958407 CAGTGTGGAGGAAGGTTGGGAGG - Intronic
966941489 3:184750674-184750696 CAGGCTGCATGGAGGGTGGGTGG + Intergenic
967000340 3:185327944-185327966 CAGGAAGGAGGGAGGGAGGGAGG + Intronic
967322996 3:188212638-188212660 AAGGGTGGGGGCAGGGTGGGGGG - Intronic
967789456 3:193531352-193531374 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
967959060 3:194904995-194905017 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
968095235 3:195925268-195925290 CAGGAGGGTGGGAGGGTGGGAGG - Intergenic
968474315 4:795789-795811 CCGGGTGGAGAGGGGGTGGGGGG + Intronic
968554927 4:1242061-1242083 CAGGATGCACTGAGGGTCGGAGG - Intronic
968598936 4:1500188-1500210 CAGGGTGGCAGGAGGATGGCAGG - Intergenic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968905884 4:3450270-3450292 CAGGCTGTACGGAGGCTGGGAGG + Intergenic
968928634 4:3563576-3563598 CCACGTGGACGGCGGGTGGGAGG - Intergenic
968973198 4:3807089-3807111 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
969100620 4:4765546-4765568 CTGGGTTGAAGGTGGGTGGGAGG - Intergenic
969350724 4:6596603-6596625 CAGGGAGGATGGATGGTAGGAGG - Intronic
969425625 4:7122238-7122260 CAGGAAGGAGGGAGGGAGGGAGG - Intergenic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969548455 4:7848069-7848091 GTGGGTGGACGGAAGGAGGGAGG + Intronic
970120435 4:12747108-12747130 CAAAGTGGACAGTGGGTGGGAGG - Intergenic
970502335 4:16690515-16690537 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
970522399 4:16898813-16898835 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
971068124 4:23058590-23058612 CAGGGTGGAGTGAGGGTTGAGGG + Intergenic
971461733 4:26906274-26906296 GAGGGTGGAGGGTGGGAGGGAGG + Intronic
971602632 4:28614769-28614791 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972785863 4:42326448-42326470 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
973367339 4:49218449-49218471 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
973392366 4:49567231-49567253 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
974093256 4:57334723-57334745 CAGGGTTGACTGTGGGTTGGTGG + Intergenic
974239760 4:59231658-59231680 GAGGGTGGACGGTGGGAGGATGG - Intergenic
974435890 4:61856918-61856940 GAGGGAGGAGGGAGGGCGGGAGG - Intronic
974716163 4:65670530-65670552 GAGGAGGGAAGGAGGGTGGGAGG - Intergenic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975177410 4:71303802-71303824 AAGGAAGGACGGAGGGAGGGAGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975400325 4:73929960-73929982 CAAGGAGGGTGGAGGGTGGGAGG + Intergenic
975985400 4:80197556-80197578 GGGGGTGGAGGGAGGGAGGGAGG - Intronic
976567926 4:86574046-86574068 TGGGGTGGAGGGAGGGTGGAAGG - Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
977978705 4:103297393-103297415 CACACTGGATGGAGGGTGGGAGG - Intergenic
977982109 4:103336473-103336495 CAGGGAGGAGGAAGGGAGGGAGG - Intergenic
978038913 4:104033666-104033688 CAGGGAGGTGGGAGTGTGGGAGG + Intergenic
978285610 4:107073469-107073491 CAGGGTGGGGGGAGGGGGAGTGG - Intronic
978364299 4:107964625-107964647 CAGGGGGGTGGGGGGGTGGGGGG - Intergenic
978400910 4:108329667-108329689 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
978706477 4:111718808-111718830 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
979138491 4:117141972-117141994 CAGAGGGTAAGGAGGGTGGGTGG + Intergenic
979698555 4:123640969-123640991 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
981012725 4:139942147-139942169 AAGGAAGGACGGAGGGAGGGAGG + Intronic
981079025 4:140619936-140619958 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981429849 4:144646036-144646058 CAGGGTGGAGGGAAGGGGAGGGG - Exonic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981552145 4:145952870-145952892 CAGGGTGGAGGGATGGTGGCAGG - Intergenic
981811828 4:148784265-148784287 CAGGATGGACTGATGGTGGCGGG + Intergenic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982223137 4:153141665-153141687 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
982816489 4:159891937-159891959 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
982963612 4:161873516-161873538 TGGGATGGAGGGAGGGTGGGAGG - Intronic
983746411 4:171205538-171205560 CATGGAGGATGGAGTGTGGGAGG + Intergenic
984296718 4:177862561-177862583 CGTGGTGAGCGGAGGGTGGGGGG - Intronic
984534775 4:180960664-180960686 CAGGGGAGACGGGGGGTGGGGGG - Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985300937 4:188488681-188488703 GACGGTGGAGGGAGGGAGGGAGG - Intergenic
985520645 5:372659-372681 CGGTGCAGACGGAGGGTGGGAGG - Intronic
985570318 5:641220-641242 CAGCGTGGAGGGAGCCTGGGAGG - Intronic
985578719 5:685590-685612 GAGGGCGGAGGGAGGGTGAGTGG - Intronic
985604537 5:851275-851297 CCGGGTGGACAGTGGCTGGGAGG + Intronic
985670751 5:1205431-1205453 CAGAGAGGACTGGGGGTGGGGGG - Intronic
985747373 5:1654941-1654963 CAGGGTGGATGGTGGGGGTGGGG - Intergenic
985751196 5:1677129-1677151 CAGGGTGAATGAAGAGTGGGAGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986065370 5:4229574-4229596 CAGGGTTGGCGGGGGGTGCGAGG - Intergenic
986078455 5:4363254-4363276 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
986078462 5:4363269-4363291 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
986328624 5:6701283-6701305 CAGGGTTGACGGAAAGTTGGGGG + Intergenic
986428699 5:7660209-7660231 AAGGATGGAGGGAGGGAGGGAGG + Intronic
987774135 5:22342536-22342558 AAGGGAGGAGGGAGGGAGGGAGG - Intronic
987774146 5:22342563-22342585 AAGGATGGAGGGAGGGAGGGAGG - Intronic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988595474 5:32586177-32586199 CAGGTTGGTCGGAGGGGGCGTGG - Intronic
988623636 5:32848437-32848459 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
989164036 5:38417565-38417587 TGGGGTGGACGGGGGGTGGAGGG - Intronic
989240222 5:39194891-39194913 CAGGGATTAAGGAGGGTGGGTGG + Intronic
989305140 5:39946556-39946578 CAAGAGGCACGGAGGGTGGGGGG - Intergenic
990200995 5:53374157-53374179 CAGAAAGGCCGGAGGGTGGGAGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991947624 5:71915010-71915032 GTGGGTGGGCGGAAGGTGGGGGG + Intergenic
992077173 5:73202233-73202255 CAGGGCGGAGGGAGGGAGGGAGG + Intergenic
992265686 5:75016138-75016160 GAGGGTGGGGGGTGGGTGGGTGG + Intergenic
992787398 5:80183285-80183307 TGGGGTGGAGGGAGGGTGGAGGG + Intronic
992978662 5:82142661-82142683 CAGTGTGGAGGGTGCGTGGGAGG + Intronic
993004455 5:82415552-82415574 ATGGGTGGAAGGAGAGTGGGTGG + Intergenic
993168439 5:84384922-84384944 CAGGGCGGGCGGAGGGCGGGCGG - Intergenic
993783152 5:92094945-92094967 ACAGGAGGACGGAGGGTGGGAGG - Intergenic
994957527 5:106552554-106552576 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
995028077 5:107447676-107447698 CAGGATGGACGAAGGGGAGGGGG + Intronic
995031967 5:107491303-107491325 AAGGGAGGAAGGAGGGAGGGAGG - Intronic
995662979 5:114506782-114506804 GAGGGTGGAAGGTGGGAGGGAGG + Intergenic
995691861 5:114835411-114835433 GAGGGTGGACGGTAGGAGGGAGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996305623 5:122043998-122044020 AAGGGTGGAGGGTGGGTGGAGGG - Intronic
996595077 5:125191447-125191469 GAGGAGGGAGGGAGGGTGGGAGG - Intergenic
996887197 5:128371492-128371514 AAGGATGGAGGGAGGGAGGGAGG - Intronic
997732780 5:136192978-136193000 CAGAGCGCACGGAGGGCGGGTGG + Intergenic
997980458 5:138465012-138465034 CAGGGAGGAGGGAGGGAGCGAGG + Intergenic
998133776 5:139664179-139664201 CAGGGAGGAGGGTGGATGGGTGG + Intronic
998382420 5:141735287-141735309 CAGGGTGGGCGGTGGTGGGGGGG + Intergenic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
999254742 5:150204052-150204074 CAGGGAGGATGGCAGGTGGGCGG + Intronic
999701606 5:154233615-154233637 CATGGTGGGCGGCTGGTGGGGGG - Intronic
999742682 5:154568540-154568562 GAGGCTGGACTGGGGGTGGGAGG + Intergenic
999872334 5:155765427-155765449 GAGGGAGGAGGGAGGGTGGGAGG + Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1000984840 5:167855679-167855701 AAGGAAGGAGGGAGGGTGGGAGG + Intronic
1001089026 5:168723337-168723359 GTGGGTGGATGGATGGTGGGAGG - Intronic
1001312127 5:170618540-170618562 GAGGGAGGAGGGAGGGAGGGAGG + Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1001809720 5:174618503-174618525 CATGGTTCAGGGAGGGTGGGTGG - Intergenic
1001831757 5:174794888-174794910 CAGGGGGGACGGGGGGGGGTGGG - Intergenic
1001898896 5:175406173-175406195 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1001925885 5:175636830-175636852 AAGGGTGGAAGGTGGGAGGGTGG + Intergenic
1002105733 5:176878730-176878752 CAGGCGGGAGGGAGAGTGGGTGG - Intronic
1002292797 5:178211205-178211227 CAGGGTCGAGGGAGGCGGGGGGG + Intronic
1002355695 5:178627218-178627240 CCGGGTGGGCGGGGGGGGGGGGG - Intronic
1002466662 5:179412013-179412035 GAGGGTGGAAGGCCGGTGGGGGG - Intergenic
1002466762 5:179412245-179412267 GAGGGTGGAAGGTCGGTGGGGGG - Intergenic
1002466782 5:179412291-179412313 GAGGGTGGAAGGTCGGTGGGGGG - Intergenic
1002466912 5:179412588-179412610 GAGGGTGGAAGGTCGGTGGGGGG - Intergenic
1002467021 5:179412842-179412864 GAGGGTGGAAGGTCGGTGGGGGG - Intergenic
1002467032 5:179412865-179412887 GAGGGTGGAAGGTCGGTGGGGGG - Intergenic
1002494627 5:179603413-179603435 CAGGCAGGGCGGAGGGTGGGAGG - Intronic
1002520793 5:179792460-179792482 CAGGGAGGAAGGAGGCTGAGTGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002607289 5:180390753-180390775 CAGGATGGATGGAGGTTGGGAGG - Intergenic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003564443 6:7211301-7211323 CAGGTGGGTGGGAGGGTGGGTGG + Intronic
1005223992 6:23620167-23620189 GAGGGGGGAGGGAGGGAGGGAGG + Intergenic
1005982648 6:30848221-30848243 CAACCTCGACGGAGGGTGGGAGG - Intergenic
1006338934 6:33435341-33435363 CAGGGGTGATGGAAGGTGGGGGG + Intronic
1006375685 6:33670582-33670604 AGGGGTGGAGGCAGGGTGGGCGG + Intronic
1006449817 6:34099420-34099442 CGGGGTGGAGGGGAGGTGGGCGG + Intronic
1006618227 6:35343865-35343887 CAGGGTGGAGGGTGGGAGTGAGG - Intronic
1006827758 6:36948668-36948690 GAGGGAGGAAGGAGGGAGGGAGG - Intronic
1006922264 6:37634754-37634776 CAAGGTGGAGGGGGGATGGGGGG - Exonic
1007223535 6:40296991-40297013 CGGGGTGGGCTGGGGGTGGGGGG + Intergenic
1007400538 6:41600113-41600135 CAGGGTGGATGGAGGAGGGGTGG - Exonic
1007825884 6:44600320-44600342 CAGGGTGGATGCAGTGTAGGAGG - Intergenic
1008285088 6:49639871-49639893 AATGGTGGTGGGAGGGTGGGAGG + Intergenic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008499256 6:52164398-52164420 GAGGGTGGACAGACTGTGGGAGG + Intergenic
1008628199 6:53338089-53338111 AAGGGTGGATGGTGGGTGGGTGG + Intronic
1008729635 6:54465914-54465936 AAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1009319561 6:62270323-62270345 AAAGGTGGGCGGGGGGTGGGTGG - Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1010357239 6:74948375-74948397 AAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1010918598 6:81652050-81652072 CTTGGGGGATGGAGGGTGGGAGG - Intronic
1011410264 6:87059800-87059822 CAGGGAGGAGGCAGGCTGGGGGG + Intergenic
1012398965 6:98828861-98828883 CCGGGAGGACGGCGGTTGGGGGG - Intergenic
1013877800 6:114855524-114855546 CAGGGTGGCCAGATGCTGGGGGG + Intergenic
1014098316 6:117482999-117483021 CTGGGGGGACGGAGCGCGGGAGG + Intronic
1014356059 6:120411649-120411671 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
1014377694 6:120696440-120696462 AAGGAAGGAAGGAGGGTGGGAGG + Intergenic
1014708577 6:124779289-124779311 CAGGAAGGAGGGAGGGAGGGAGG + Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015764372 6:136700134-136700156 AAGGGAGGAAGGAGGGAGGGAGG + Intronic
1015837277 6:137433991-137434013 AAGGGAGAAGGGAGGGTGGGAGG - Intergenic
1015998510 6:139018837-139018859 CAGGAGGGAGGGAGGGAGGGAGG + Intergenic
1016811488 6:148265354-148265376 AAGGAGGGACGGAGGGAGGGAGG + Intergenic
1016981652 6:149860400-149860422 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1017206486 6:151808409-151808431 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017931905 6:158963391-158963413 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018356546 6:163023216-163023238 GAGGGTGGAAGGAGGGGGGTGGG - Intronic
1018396254 6:163380114-163380136 CAGGGAGGATGCAGGGTTGGAGG - Intergenic
1018639002 6:165889891-165889913 GAGGGAGGAGGGAGGGAGGGAGG - Intronic
1018698018 6:166405699-166405721 CAGGGTGGAGGCAGAGTGTGTGG + Intergenic
1018974234 6:168552821-168552843 CAGGCTGGTGGGGGGGTGGGGGG - Intronic
1019051579 6:169187994-169188016 CAGGGGGGACGGGGAGCGGGGGG - Intergenic
1019287404 7:230511-230533 GTGGGTGGATGGAGGGTGGCCGG + Intronic
1019313499 7:374132-374154 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1019381823 7:727796-727818 CAGGCAGGGAGGAGGGTGGGAGG - Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019420056 7:946563-946585 CAGGAGGGAGAGAGGGTGGGAGG - Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019643712 7:2118093-2118115 CAGGGTGGAGGGTGGGTAAGGGG - Intronic
1019861967 7:3667393-3667415 CAGGGTAGGAGGAGGTTGGGAGG - Intronic
1019920039 7:4157525-4157547 GAGGGAGGAAGGAAGGTGGGTGG + Intronic
1020005687 7:4782867-4782889 CAGGGAGGAGGGCGGCTGGGTGG - Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1020369604 7:7417519-7417541 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1021164924 7:17325800-17325822 CAGGGTGGGAGGAGGGAGAGAGG + Intronic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021747930 7:23762227-23762249 CGGGGTGGAGGGAGGGGGGAGGG - Intronic
1021766877 7:23958516-23958538 AAGGGTGGAGGGAGGGGGGTAGG - Intergenic
1021902630 7:25302397-25302419 AAAGGCGGACGGTGGGTGGGGGG - Intergenic
1021921003 7:25484717-25484739 CAGGGTGGAGGGTGGGTGAAAGG + Intergenic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022661736 7:32374077-32374099 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1023003541 7:35838349-35838371 GAGGGAGGAGGGAGGGAGGGAGG - Intronic
1023255217 7:38306129-38306151 CAGGGTGGGGGTGGGGTGGGGGG + Intergenic
1023372201 7:39522653-39522675 AGGGGGGGACGGAGGGAGGGAGG + Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023743321 7:43300478-43300500 GAGGGTGGAAGAAGGGTGGAAGG + Intronic
1023782871 7:43673993-43674015 AAAGGTGGAGGGAGGGAGGGAGG + Intronic
1024260924 7:47573333-47573355 CAGGGTGTCCCCAGGGTGGGAGG - Intronic
1024867418 7:53919857-53919879 CAGGGTGGAATGGGGTTGGGAGG + Intergenic
1024948505 7:54834775-54834797 GAGGGTGGGAGCAGGGTGGGTGG - Intergenic
1025064112 7:55838509-55838531 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1025151203 7:56552372-56552394 AAGGAGGGACGGAGGGAGGGAGG - Intergenic
1025957355 7:66193208-66193230 AAGGATGGAGGGAGGGAGGGAGG + Intergenic
1026017704 7:66683665-66683687 CAGGGTGGAGTGAGGGAGAGGGG + Intronic
1026025807 7:66742543-66742565 CAGGGTGGAGTGAGGGAGAGGGG + Intronic
1026112412 7:67469095-67469117 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1026114214 7:67482786-67482808 CAGGGTGGTAGCAGTGTGGGTGG - Intergenic
1026492165 7:70872240-70872262 GAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1026509405 7:71015872-71015894 CAGGGTGGAGGTAGGGGGAGGGG + Intergenic
1026533856 7:71223702-71223724 CATGGAGGGTGGAGGGTGGGAGG - Intronic
1026638641 7:72105784-72105806 GAGGGGGGAGGGAGGGAGGGAGG + Intronic
1026662846 7:72317254-72317276 AGGGGGGGACGGAGGGAGGGAGG + Intronic
1027163475 7:75818696-75818718 GAGGCTGGAGGGTGGGTGGGAGG + Intronic
1027540344 7:79456650-79456672 TAGGGTGGAGGGTGGGTAGGGGG + Intergenic
1028415793 7:90579219-90579241 CAGGGAGGGAGGAGCGTGGGTGG + Intronic
1028636773 7:92997962-92997984 AAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1028757966 7:94459784-94459806 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1028883740 7:95909227-95909249 GAGGGTGGGAGGGGGGTGGGGGG + Intronic
1029084946 7:98004068-98004090 AAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1029448438 7:100627501-100627523 CAGGGTGGACGCTGGGGCGGAGG + Intronic
1029585370 7:101467356-101467378 CAGGGCGGGGGGAGGATGGGGGG + Intronic
1029666187 7:101996654-101996676 AAGGATGGATGGAGGGAGGGAGG - Intronic
1029980625 7:104875342-104875364 GAGGGTGGCTGGAGGGTGTGAGG - Intronic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032078625 7:128847882-128847904 CAGGGAGGAGGGAGGTGGGGCGG + Intronic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032527332 7:132588677-132588699 AAGGGAGGAGGGAGGGAGGGAGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032989819 7:137381300-137381322 CGAAGTGGAGGGAGGGTGGGTGG - Intronic
1033769050 7:144527942-144527964 GAGGGTGGGAGGCGGGTGGGAGG + Intronic
1034457939 7:151181542-151181564 CAGGATGGAGGGTGGGTGGGGGG - Intronic
1034471696 7:151258098-151258120 CAGAGTGGATGTAGGGTGTGAGG - Intronic
1034657034 7:152737811-152737833 CTGGGTGGAAGGAGTGTGGTGGG - Intergenic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1034896183 7:154877879-154877901 CAGTGTGGAAGGAGGATGGGTGG + Intronic
1035023010 7:155809818-155809840 CAGGGCGGACGGGGGTCGGGGGG + Intronic
1035459783 7:159031604-159031626 TAGGGTGGACGGAAGGACGGCGG + Intronic
1035468858 7:159097090-159097112 CAGGGTTGCAGGAGGGTTGGCGG + Intronic
1035472851 7:159121183-159121205 CAGCATGGAGGGAGGGAGGGAGG - Intronic
1035527433 8:324726-324748 AGGGGTGGATGGAGGGAGGGAGG + Intergenic
1035549979 8:514816-514838 CAGGGTGGGAGGAGGCTGAGAGG - Intronic
1035683673 8:1507793-1507815 GTGGGTGGAGGGAGGGTGGTGGG - Intronic
1035702136 8:1644206-1644228 CAGGCAGGATGGAGAGTGGGTGG - Intronic
1035898860 8:3435664-3435686 GAGGTAGGACGGAAGGTGGGTGG - Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1035971916 8:4258416-4258438 GAGGATGGAAGGAGGGAGGGAGG + Intronic
1036495763 8:9268581-9268603 AAGGGGGGAAGGAGGGGGGGAGG + Intergenic
1036505045 8:9347473-9347495 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1036635594 8:10547957-10547979 CAGGGAAGAAGGAGTGTGGGCGG + Intronic
1037892390 8:22630143-22630165 CAGGGTGGAGGCCGGGTGGCTGG + Intronic
1037905669 8:22714731-22714753 CAGGCAGGTGGGAGGGTGGGTGG - Intronic
1038543111 8:28405251-28405273 CAGAGTGAATGGAGGGTTGGAGG + Intronic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1038820931 8:30951248-30951270 AAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1039065969 8:33607793-33607815 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1039335467 8:36584371-36584393 TAGAGTGGAGAGAGGGTGGGGGG - Intergenic
1039436674 8:37564259-37564281 AAGGGTGGACTGTGGGTGTGCGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041301977 8:56421088-56421110 TGGGGTGGAGGGAGGGGGGGAGG + Intergenic
1041449118 8:57988764-57988786 GGGGGTGGGCGGGGGGTGGGGGG + Intergenic
1042054883 8:64754132-64754154 CAGAGGGGACAGAGGGTGTGAGG + Intronic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1043835134 8:85036827-85036849 GAGGGCGGAGGGAGGGAGGGAGG + Intergenic
1044056700 8:87579514-87579536 CAGAAAGGAGGGAGGGTGGGAGG + Intronic
1044113827 8:88309432-88309454 GAGGGTGGTAGGAGGGAGGGGGG + Intronic
1044545957 8:93459672-93459694 GAGGGTGGACGGTGGGAGGAGGG - Intergenic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1044840005 8:96329372-96329394 CAGGAGGGAGGGAGGGTGAGCGG - Intronic
1045084975 8:98672241-98672263 CATGGTGGGCGGTGGGTGTGGGG + Intronic
1045321778 8:101087243-101087265 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1045511211 8:102813263-102813285 CAGGGTGGATGGTGGGTGGCAGG + Intergenic
1045554204 8:103199800-103199822 GAGGGTGGAGGGTGGGAGGGAGG - Intronic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046073154 8:109282671-109282693 CGGGGTTGTCGGGGGGTGGGGGG + Intronic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1046946250 8:119976845-119976867 CAGGGTGTGCGGGGGGAGGGTGG - Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047398421 8:124525105-124525127 AAGTGTGGAAGGATGGTGGGTGG - Intronic
1047827043 8:128588113-128588135 GGGGGTGGAAGGAGGGTGGATGG - Intergenic
1047870654 8:129078080-129078102 CATGGTGGAGGGAGTGGGGGAGG + Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1049048747 8:140174217-140174239 CTTGGAGGATGGAGGGTGGGAGG + Intronic
1049115783 8:140686245-140686267 GAGGGTGGGAGGAGGGTGAGAGG + Intronic
1049243988 8:141551795-141551817 CATGGAGGTCGGGGGGTGGGGGG - Intergenic
1049271081 8:141696643-141696665 CAGGCTGGAAGGAAGGTGGAGGG - Intergenic
1049311789 8:141937407-141937429 GAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1049350625 8:142162610-142162632 AAGGATGGATGGAGGATGGGTGG + Intergenic
1049356783 8:142193009-142193031 CAGGGATGAAGGAGAGTGGGAGG + Intergenic
1049364282 8:142229206-142229228 AAGGGTGGATGGTGGGTGGATGG + Intronic
1049530450 8:143151920-143151942 CAGGGTGGACGGAAGGTGGCGGG - Intergenic
1049554861 8:143276839-143276861 CGGGGTGGAGGGTGGGTTGGGGG - Exonic
1049573009 8:143378364-143378386 CAGGGCTGCAGGAGGGTGGGTGG - Intronic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049691838 8:143964992-143965014 CAGGGTGGGCGGGGGGGTGGGGG - Intronic
1049746555 8:144265610-144265632 CAGGCTGGAAGGAGCGAGGGTGG - Intronic
1049764891 8:144350580-144350602 CAGGGAGGAGGGAGGGAGAGAGG - Intergenic
1050003568 9:1103785-1103807 ATGGGAGGATGGAGGGTGGGAGG - Intergenic
1050223191 9:3420105-3420127 AAGGATGGTCGGAGGCTGGGAGG - Intronic
1050744181 9:8857908-8857930 AGGGGTGGAGGGAGGGCGGGGGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1052878878 9:33587968-33587990 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1052880206 9:33597197-33597219 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1052894125 9:33731601-33731623 CAGGTTGGAGGGAAGCTGGGAGG - Intergenic
1052940306 9:34127094-34127116 CAGGGGGGTGGGGGGGTGGGGGG + Intronic
1053231743 9:36416179-36416201 CAGGGCGGAGGGAGGGGGAGGGG + Intronic
1053337286 9:37286928-37286950 AAGGGGGGAGGGAGGGAGGGAGG - Intronic
1053337314 9:37286977-37286999 GAGGGGGGAGGGAGGGAGGGAGG - Intronic
1053495766 9:38547021-38547043 TAGGGTGGTGGGAGGGTGGTGGG - Intronic
1053497095 9:38556252-38556274 TAGGGTGGTGGGAGGGTGGTGGG - Intronic
1053663169 9:40298666-40298688 TAGGGTGGTCGGAGGGTGGTGGG + Intronic
1053664146 9:40305738-40305760 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053664622 9:40308753-40308775 TAGGGTGGTCGGAGGGTGGTGGG + Intronic
1053665113 9:40311943-40311965 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053665530 9:40314890-40314912 TAGGGTGGTGGGAGGGTGGTGGG + Intronic
1053666421 9:40321035-40321057 TAGGGTGGTAGGAGGATGGGGGG + Intronic
1053803517 9:41778717-41778739 CCACGTGGACGGCGGGTGGGAGG - Intergenic
1053913674 9:42929196-42929218 TAGGGTGGTCGGAGGGTGGTGGG + Intergenic
1053914694 9:42936993-42937015 TAGGGTGGTGGGAGGGTGGGTGG + Intergenic
1053916007 9:42946081-42946103 TAGGGTGGTAGGAGGGTGGGGGG + Intergenic
1054141748 9:61536407-61536429 CCACGTGGACGGCGGGTGGGAGG + Intergenic
1054191811 9:61990030-61990052 CCACGTGGACGGCGGGTGGGAGG - Intergenic
1054375293 9:64444890-64444912 TAGGGTGGTCGGAGGGTGGTGGG + Intergenic
1054376274 9:64451973-64451995 TAGAGTGGTGGGAGGGTGGGTGG + Intergenic
1054376683 9:64454920-64454942 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1054461500 9:65467586-65467608 CCACGTGGACGGCGGGTGGGAGG + Intergenic
1054518188 9:66055248-66055270 TAGGGTGGTAGGAGGATGGGGGG - Intergenic
1054519084 9:66061394-66061416 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1054519503 9:66064341-66064363 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054519992 9:66067531-66067553 TAGGGTGGTCGGAGGGTGGTGGG - Intergenic
1054520469 9:66070547-66070569 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054646559 9:67597682-67597704 CCACGTGGACGGCGGGTGGGAGG + Intergenic
1055600899 9:77917357-77917379 GAGGGCGGAAGGAGGGTGGGGGG + Intronic
1055936265 9:81607387-81607409 TAGGGTGGAAGGCTGGTGGGTGG - Intronic
1055963512 9:81843158-81843180 CAGGGTGGAGGGAGTTAGGGGGG + Intergenic
1055990982 9:82105340-82105362 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1056585881 9:87926833-87926855 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1056586334 9:87929862-87929884 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1056610548 9:88123081-88123103 TAGGGTGGTGGGAGGGTGGTGGG + Intergenic
1056611003 9:88126110-88126132 TAGGGTGGTGGGAGGGTGGGGGG + Intergenic
1056679153 9:88701927-88701949 GAGGGTGGCCTGGGGGTGGGGGG + Intergenic
1056737697 9:89223930-89223952 CACTGTGGAGGGAGGGAGGGAGG - Intergenic
1056905380 9:90642917-90642939 CAGGGAGCACGGCCGGTGGGCGG - Exonic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057196057 9:93116025-93116047 GAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1057283933 9:93732689-93732711 CAGGGGGGAGGGAGAGAGGGAGG + Intergenic
1057305208 9:93908348-93908370 CAGGGGGGTAGGTGGGTGGGTGG + Intergenic
1057380492 9:94563079-94563101 CATGGTGAACGGTGGGTGTGAGG + Intronic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057675698 9:97134536-97134558 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1057676150 9:97137608-97137630 TAGGGTGGTGGGAGGGTGGTGGG - Intergenic
1057695202 9:97318271-97318293 AAGGAGGGACAGAGGGTGGGTGG - Intronic
1057905235 9:98977715-98977737 CTAGGGGGATGGAGGGTGGGAGG + Intronic
1058424509 9:104864738-104864760 CAGGGTGGCAGAAGTGTGGGAGG + Intronic
1058633424 9:107012737-107012759 AAGGGTTGTGGGAGGGTGGGAGG + Exonic
1058935764 9:109767907-109767929 CAGGATGGAAGGAGGGAAGGTGG + Intronic
1058976935 9:110133651-110133673 CGGGGTGGGCGGAGGGTAGTGGG - Intronic
1059234467 9:112750631-112750653 AAGGAAGGACGGAGGGAGGGAGG - Intergenic
1059416534 9:114166057-114166079 CTGGCTGGATGGATGGTGGGTGG - Intronic
1059505983 9:114800299-114800321 CTGGATGGAGGGAGGGTTGGAGG - Intronic
1059520263 9:114934214-114934236 CAGGCTGAAAGGAGGCTGGGTGG - Intergenic
1059581600 9:115555521-115555543 CATGGTGGCAGGAGGGTGGAGGG + Intergenic
1059660481 9:116395268-116395290 CAGGATGGAGAGAGGTTGGGAGG + Intronic
1059669380 9:116478228-116478250 AAGGGGGGAGGGAGGGAGGGAGG + Intronic
1060116430 9:120945049-120945071 AAGGGTGGTCGGTGGGAGGGGGG - Intergenic
1060389497 9:123267217-123267239 GAGGTAGGACGGAGGGTGAGGGG - Intronic
1060402777 9:123357935-123357957 CAGAGTGGATGGAGGCTGTGGGG + Intronic
1060547649 9:124470456-124470478 CAGGGCTGACGGGGGTTGGGAGG - Intronic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1060824338 9:126679388-126679410 GAGGGTGGATGGAGGGGGGATGG + Intronic
1060867946 9:127014676-127014698 CAGGGAGGCCTGGGGGTGGGGGG + Intronic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061450657 9:130665311-130665333 GGGGGTGGAGGGAGGGCGGGCGG + Intronic
1061620917 9:131810697-131810719 TGGGCAGGACGGAGGGTGGGTGG + Intergenic
1061820742 9:133226040-133226062 GAGGGAGGAGGGAGGGTGGGTGG + Intergenic
1062021211 9:134320226-134320248 TCTGCTGGACGGAGGGTGGGGGG - Intronic
1062050652 9:134444798-134444820 GAGGGAGGAAGGAGGGAGGGAGG - Intergenic
1062060937 9:134494666-134494688 CGGGGTGGATGGGGGGTGGGTGG + Intergenic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062111717 9:134785562-134785584 CAGGGTGGAGCCAGGGTGTGTGG - Intronic
1062144506 9:134981517-134981539 CAGGGAGGAGGGATGGTGAGAGG + Intergenic
1062144542 9:134981732-134981754 CAGGGAGGAGGGATGGTGAGAGG + Intergenic
1062144566 9:134981846-134981868 CAGGGAGGAGGGATGGTGAGAGG + Intergenic
1062170816 9:135133701-135133723 CAGGGTGCAGGGAGGGTGACTGG + Intergenic
1062188213 9:135229839-135229861 CAGGGTGTGCGCACGGTGGGAGG - Intergenic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062426960 9:136510535-136510557 CAGGGAGGCCGGAGTGTGGCCGG - Intronic
1062517896 9:136945287-136945309 CAGGGTGGCAGGACTGTGGGAGG - Exonic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062630650 9:137461699-137461721 CAGAGAGGGCGCAGGGTGGGTGG - Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062649735 9:137569419-137569441 CTGGATGGATGGATGGTGGGTGG - Intronic
1203744573 Un_GL000218v1:34822-34844 CAGGGTGGAGGGAGGCTGAAGGG + Intergenic
1185599286 X:1327857-1327879 CACGGTGGGTGGAGGGTGGGGGG + Intergenic
1185775185 X:2797383-2797405 GATGGTGGGTGGAGGGTGGGAGG + Intronic
1185918913 X:4067242-4067264 GAGGGGGGAGGGAGGGAGGGAGG - Intergenic
1186500200 X:10044872-10044894 ATGGGGGGACGGAGGGAGGGAGG - Intronic
1187447646 X:19373058-19373080 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187671509 X:21670837-21670859 GAGGGTGGAAGGGGGGTGTGGGG - Intergenic
1188060995 X:25601953-25601975 CAGGGAGGAGGGAGGAAGGGAGG - Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1188415476 X:29927887-29927909 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1188554815 X:31399431-31399453 CAGGTTGGGGGGTGGGTGGGGGG + Intronic
1188586010 X:31776601-31776623 GAGGGAGGAAGGAGGGAGGGAGG + Intronic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1190225161 X:48539647-48539669 CAGGTGGGAGGGACGGTGGGGGG + Exonic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1191672692 X:63763452-63763474 CGGGGTGGAGGGAGGGGGTGGGG - Intronic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1192033949 X:67544342-67544364 CAGGGTGGGGGGAGGCGGGGTGG - Intronic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192182534 X:68925293-68925315 CAGGGTGGGTGGGGGGAGGGGGG - Intergenic
1192306004 X:69960223-69960245 CAGGATGGAAGCAGTGTGGGTGG + Intronic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1193708098 X:84847196-84847218 CAGGGTGGGCTGTGGGTGGAGGG + Intergenic
1193777804 X:85665046-85665068 CAGGGTGGGGGGAGGGGGAGGGG + Intergenic
1193893343 X:87079735-87079757 TAGGGTGGGAGGAGGGGGGGAGG - Intergenic
1193922173 X:87443266-87443288 TGGGGTGGAGGGAGGGGGGGAGG - Intergenic
1194101551 X:89711689-89711711 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1194322681 X:92471256-92471278 CTTGGAGGATGGAGGGTGGGAGG - Intronic
1194707143 X:97189446-97189468 AAGGGAAGAGGGAGGGTGGGAGG - Intronic
1196196888 X:112846267-112846289 AAGGGTGGAAGGGGGGAGGGAGG - Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196706831 X:118724275-118724297 CATGGGGGACAGTGGGTGGGTGG + Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1197608385 X:128610598-128610620 GAGGGTGGAGGGTGGGTGGGGGG + Intergenic
1197689084 X:129477783-129477805 CAGGGAGGTGGGTGGGTGGGTGG - Intronic
1197908340 X:131451194-131451216 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198421422 X:136473256-136473278 TAGGTGGGAAGGAGGGTGGGAGG + Intergenic
1198974685 X:142323048-142323070 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1199344671 X:146724285-146724307 AAGGAAGGAGGGAGGGTGGGTGG + Intergenic
1199680042 X:150217892-150217914 GGGGGTGGGGGGAGGGTGGGAGG + Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199740325 X:150729606-150729628 CAGGGTGGCAGGGTGGTGGGTGG - Intronic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1199832945 X:151562811-151562833 CGGGGGGGGCGGGGGGTGGGGGG + Intergenic
1200022802 X:153226096-153226118 CAGGCTGGAGGGAGGGTGGAAGG + Intergenic
1200071003 X:153529315-153529337 CAGGGTGGGGGTAGGGTGTGTGG + Intronic
1200418223 Y:2935340-2935362 TAGGGCGGGCGGAGGGAGGGAGG - Intronic
1200454499 Y:3372775-3372797 GAGGGTGGAGGGTGGGTGGAGGG - Intergenic
1200567614 Y:4786430-4786452 GATGGAGGATGGAGGGTGGGAGG + Intergenic
1200630832 Y:5584734-5584756 CTTGGAGGATGGAGGGTGGGAGG - Intronic
1200684369 Y:6246095-6246117 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200687012 Y:6266419-6266441 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200992559 Y:9357669-9357691 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1200997876 Y:9398293-9398315 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201003047 Y:9487139-9487161 CAGGGAAGGCGGGGGGTGGGGGG + Intronic
1201005706 Y:9507422-9507444 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201008366 Y:9527752-9527774 CAGGGAAGGCGGGGGGTGGGGGG + Intergenic
1201048265 Y:9908291-9908313 CAGGGAAGGCGGGGGGTGGGGGG - Intergenic
1201157909 Y:11149805-11149827 CAGGGTGGAGGGAGGCTGAGGGG + Intergenic
1201550396 Y:15211835-15211857 AAGGGAGGAGGGAGGGAGGGAGG + Intergenic
1202100606 Y:21303869-21303891 CTGGGTGGACGCAGGCTTGGCGG - Intergenic