ID: 1175884778

View in Genome Browser
Species Human (GRCh38)
Location 20:62283517-62283539
Sequence GGGTTGTTATTGATGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175884770_1175884778 23 Left 1175884770 20:62283471-62283493 CCCTTTTAGAATCGAGAGCTCTG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1175884778 20:62283517-62283539 GGGTTGTTATTGATGAAAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 218
1175884771_1175884778 22 Left 1175884771 20:62283472-62283494 CCTTTTAGAATCGAGAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1175884778 20:62283517-62283539 GGGTTGTTATTGATGAAAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 218
1175884777_1175884778 -4 Left 1175884777 20:62283498-62283520 CCACTCTGCAAAGGTCTCTGGGT 0: 1
1: 0
2: 2
3: 28
4: 195
Right 1175884778 20:62283517-62283539 GGGTTGTTATTGATGAAAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175884778 Original CRISPR GGGTTGTTATTGATGAAAAA AGG Intronic
903915965 1:26764575-26764597 GAGTTGTTGTTGATGAACCAAGG + Intronic
905063789 1:35162369-35162391 GGATTGTGATTCTTGAAAAAAGG + Intergenic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
908493136 1:64666573-64666595 GGATTGTTAATGAAGAAAAACGG + Intronic
908969039 1:69803727-69803749 AGATTGTAATTTATGAAAAACGG - Intronic
909482503 1:76141013-76141035 GGGTTGATTTGGATGAAAGACGG + Intronic
910258388 1:85272750-85272772 GGTATGTTATTGATAAAATAAGG + Intronic
911461546 1:98197441-98197463 GGGTATTTATGGAGGAAAAAAGG - Intergenic
912194778 1:107384957-107384979 GGGTTTTTATTAATAAAGAATGG + Intronic
912603385 1:110963168-110963190 GGTGTGTGATTGAAGAAAAAGGG - Intronic
915007538 1:152653923-152653945 GGGTTTGCATTGCTGAAAAATGG - Intergenic
916239727 1:162626938-162626960 GGTTTGTTATTGATGCCAAATGG + Intergenic
916801486 1:168220472-168220494 GGGTAATTTTTGAAGAAAAAAGG + Intergenic
917727494 1:177841373-177841395 GGGTGTTGATTGATGTAAAAAGG + Intergenic
919047655 1:192473891-192473913 GGGTTGATATTGAAAAATAAGGG - Intergenic
920898870 1:210086890-210086912 GGTTTCTTACTGATGGAAAAGGG - Intronic
921128204 1:212196602-212196624 GGGTAGTTTTTGAAGAAAAGAGG - Intergenic
921387784 1:214588267-214588289 GGGTGGTTATTTAGCAAAAATGG + Intergenic
921734178 1:218608125-218608147 AGGTTGTTAGTTATCAAAAAGGG + Intergenic
924094675 1:240539014-240539036 GGGTTGATGTAGATCAAAAAGGG + Intronic
1063512464 10:6659339-6659361 GGGATGTTTTTGTTGAAAACTGG + Intergenic
1065920832 10:30391455-30391477 GGATTGGTATTGGTGACAAAGGG + Intergenic
1067340861 10:45402331-45402353 GGAATGTTTTTGATGAAAAGGGG - Intronic
1070371993 10:75791434-75791456 TGGTATTTATTGATGATAAATGG - Intronic
1070434884 10:76381553-76381575 GGGTAGTTAGTGATAAGAAAGGG - Intronic
1071257524 10:83885320-83885342 GGGTAGTTATAGTTGAAAAAAGG - Intergenic
1071853197 10:89596387-89596409 GTGTTGGTATAAATGAAAAAGGG + Intronic
1072935232 10:99705621-99705643 GGGTTGTTTTTAAAGAAAAGGGG + Exonic
1073406324 10:103301180-103301202 GGATGGTTATTGAGGAAAATAGG + Intergenic
1073696175 10:105871027-105871049 GGGTGGTGATTGATGAAAGCTGG + Intergenic
1073835169 10:107432993-107433015 GTGTTGTTTTTGAAGAAGAAAGG - Intergenic
1074196361 10:111189208-111189230 GGGTTGTCTTTGATCATAAAGGG + Intergenic
1075285052 10:121176569-121176591 GAGTTGTCACTGATGAAAAGAGG - Intergenic
1076733079 10:132447820-132447842 GGGTTGGCCTTGATGAGAAATGG - Exonic
1078344346 11:10531727-10531749 GAGTTGTTAGTAATGATAAAAGG - Intronic
1079908509 11:26279906-26279928 GGAGAGTTATTGAAGAAAAATGG - Intergenic
1080244967 11:30169461-30169483 AGGTTGTTATTGATCCATAAGGG + Intergenic
1080513984 11:33002437-33002459 GAGTGCTTATTGAAGAAAAATGG - Intergenic
1080769873 11:35330652-35330674 GGGTTCTTATGCATGAAAAAGGG + Intronic
1081114392 11:39181308-39181330 GTGTAGTGATTGATGGAAAATGG + Intergenic
1085488609 11:76891619-76891641 GACTTGTTACTGATGAAAAGAGG + Intronic
1087534135 11:99422665-99422687 GGTTTTTTATTAATGAAACAGGG + Intronic
1087905561 11:103692897-103692919 GCTTTTTTATTGAAGAAAAATGG - Intergenic
1088747270 11:112814594-112814616 GGGTTTTTATTGATGAAGGAGGG - Intergenic
1091629845 12:2151658-2151680 GGCTTTGTATTGATGAAGAAGGG + Intronic
1093408484 12:18835802-18835824 GGGTTGTTTTTGTAGATAAAAGG + Intergenic
1094264411 12:28539621-28539643 GGGATGTTATTGCCTAAAAATGG - Intronic
1094559474 12:31537610-31537632 GTGTTGTTATTGATGAGCAAGGG - Intronic
1095240745 12:39856197-39856219 GGGTTGCTATTGATAAGAGAAGG - Intronic
1096255959 12:50062665-50062687 GGGTTCTTATTGTTGAGAAGAGG - Intronic
1096853804 12:54462823-54462845 GGGTCTTTATTTCTGAAAAATGG + Intronic
1097136180 12:56857886-56857908 TGGTTCTTAGTAATGAAAAATGG - Intergenic
1098017692 12:66123697-66123719 GGGTTTGAATTGAAGAAAAAAGG + Exonic
1098496220 12:71138549-71138571 AGGTTGTGTTTGATGAAGAAAGG - Intronic
1098670666 12:73225958-73225980 GGGTTGTAATAGAACAAAAAAGG - Intergenic
1098881668 12:75923808-75923830 AGGTTGTTATAAATGGAAAATGG - Intergenic
1099018447 12:77373942-77373964 GGGTTGTTTATGAAGAAAAGAGG + Intergenic
1100853830 12:98740678-98740700 GGGTTGTTAGTGAGGAAAAGGGG - Intronic
1100936587 12:99676234-99676256 GGGTAGTTTATGATGAAAAGAGG - Intronic
1101270482 12:103138537-103138559 GGGTTATTTTTGAAGAAAAGAGG - Intergenic
1105426725 13:20301315-20301337 GGGTTTGCATTGGTGAAAAAAGG + Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1107064246 13:36195503-36195525 GGTTTGGTATTGAAGAAAAATGG + Intronic
1107181842 13:37470672-37470694 GGGTTGCAATTAATGAAAATTGG + Intergenic
1109770191 13:66961268-66961290 GGGGTTATATTGATGAAATAAGG + Intronic
1111107031 13:83659660-83659682 GGGTCGTTATAGATGTAATAAGG - Intergenic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1113830631 13:113292905-113292927 TGGTTTATTTTGATGAAAAATGG - Intergenic
1120107132 14:80508901-80508923 GGGTAGTTTATGAAGAAAAAGGG + Intronic
1120617856 14:86730204-86730226 TGGTTCTTTTTAATGAAAAATGG - Intergenic
1120658675 14:87227408-87227430 GGGTAATTAGTAATGAAAAAAGG + Intergenic
1122097207 14:99380847-99380869 GGTTGGTGATTGAAGAAAAAGGG - Intergenic
1122500343 14:102193905-102193927 GGGCTTTTATTGGTGAAATAAGG - Intronic
1122894339 14:104748723-104748745 GCTGTGTTATTGATGAAAAGTGG - Intergenic
1126063927 15:44810665-44810687 GGGGTGTTATACATGAAAGAAGG + Intergenic
1127737965 15:61863118-61863140 GACTTGTAATTCATGAAAAAGGG + Intronic
1128684186 15:69671577-69671599 GGGGTGGTCTTGATGAGAAAGGG - Intergenic
1128684386 15:69672708-69672730 GGGGTGGTCTTGATGAGAAAGGG + Intergenic
1130015432 15:80182488-80182510 GGGTATTTATTGATTAATAATGG - Intronic
1130294656 15:82636969-82636991 GTTTTTTTATTGATGAAGAATGG - Intronic
1131502576 15:92983243-92983265 AGGTTTTTATTGCTGAAGAAAGG - Intronic
1132569418 16:637576-637598 GGGTTCCCATTGGTGAAAAACGG - Intronic
1133943550 16:10329900-10329922 GGGTGGTGATTTATGGAAAAAGG - Intronic
1135651710 16:24212046-24212068 GGGGTGATACTGATGAGAAATGG - Intronic
1135818717 16:25659699-25659721 TGGTTGTGATTGAAGATAAAAGG + Intergenic
1135886381 16:26312308-26312330 GGGTTGAGATTAATGAAAAGTGG + Intergenic
1137234183 16:46600141-46600163 GAGTTGTTATTGTTAAAAATTGG - Intronic
1137641476 16:50034455-50034477 TGTTTGTTATTGACCAAAAATGG + Intronic
1137803178 16:51279536-51279558 GGGGTGATTTTGCTGAAAAAGGG + Intergenic
1140074592 16:71685614-71685636 GATTTGTTACTAATGAAAAATGG - Intronic
1140977645 16:80075544-80075566 GGGTTGTTTTTCATAAAAAATGG - Intergenic
1141225341 16:82109681-82109703 GGACTGTTATTGAAGAAAAATGG + Intergenic
1143943614 17:10569333-10569355 GTCTTGATATTGATGAAATATGG + Intergenic
1144088664 17:11833725-11833747 GGCTGGTTATTGTAGAAAAAGGG + Intronic
1144721606 17:17474951-17474973 GGGATATTATTGATGAATATTGG + Intergenic
1146597278 17:34180918-34180940 TTGTTGGTATTGATGCAAAATGG + Intergenic
1149556581 17:57577707-57577729 AGGTTCTTATTTATGAAAAAAGG + Intronic
1149903589 17:60504964-60504986 GGGTTGTTATCAAGGAAAAATGG + Intronic
1150967672 17:69990101-69990123 AGGTTTTTATTAATGAGAAAAGG - Intergenic
1151769210 17:76148878-76148900 GGGTAGTCAGTGATGGAAAAAGG - Intronic
1152039370 17:77893026-77893048 GGATGGTTATTGAGGAACAATGG - Intergenic
1203172608 17_GL000205v2_random:163041-163063 GGGTTCTTATTTATACAAAATGG - Intergenic
1153487576 18:5615837-5615859 GGGTTGTCCTTCAAGAAAAAAGG - Intronic
1155009782 18:21765542-21765564 GTGTTCTTACTAATGAAAAAGGG + Intronic
1155640675 18:28010245-28010267 TTGTTGTTACTGATGCAAAAAGG - Intronic
1157135119 18:45046429-45046451 GGGCTGCTATTAATGAACAAAGG - Intronic
1159768674 18:72522289-72522311 GGCTTGTTTTTAATGAATAAAGG - Intergenic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
1165889466 19:39101796-39101818 TGGTAGTTATTAATTAAAAAGGG - Intronic
926511819 2:13790878-13790900 GGGTTTTTAATGATGAAAAATGG + Intergenic
927293779 2:21430141-21430163 GTGTTGTTATGGATTAATAAGGG - Intergenic
927790646 2:26006716-26006738 GGGTTCTAATTGCAGAAAAAGGG + Intergenic
928011952 2:27617383-27617405 GGATTGTTAGAGATGAAAAGAGG - Intronic
929814146 2:45217976-45217998 GGGTAGTTAATAATGAAAAGAGG - Intergenic
930006494 2:46901410-46901432 GGGTAGTTCTGGATGAAGAAGGG + Intergenic
931817263 2:65916908-65916930 GCCTTGTTATTGATGATGAAGGG + Intergenic
933453876 2:82496889-82496911 GGGTTCTTGTTGAGGACAAAAGG + Intergenic
935095607 2:99941509-99941531 GGGCTGTTAGTCATGAAGAATGG - Intronic
935616008 2:105082621-105082643 GGGAGGTTTTTGAGGAAAAATGG + Intronic
936702429 2:115029055-115029077 GTGTTATTATTGATGAATAAAGG + Intronic
938202902 2:129390938-129390960 GGGGTGTTATTGATAGACAACGG - Intergenic
939009665 2:136831179-136831201 GAGTTGTTTCTGATGAAAAGAGG - Intronic
939693622 2:145296691-145296713 GAGCTGTTATTCATGACAAAGGG + Intergenic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
942139402 2:172962934-172962956 GGGTAATTTTTGAAGAAAAATGG + Intronic
943634235 2:190287687-190287709 GGGTTTTTTTTTAAGAAAAAGGG - Intronic
944929575 2:204502237-204502259 TGGTTGTTATTAATCAAGAAGGG + Intergenic
946607506 2:221421674-221421696 TGGTTGTTATAAATGAAAGAAGG - Intronic
946655739 2:221944733-221944755 GGGTTTGAATTGAAGAAAAAAGG - Intergenic
947225993 2:227840681-227840703 TGTTAATTATTGATGAAAAAAGG - Intergenic
1169801003 20:9511624-9511646 TGGTTGAAATTGATGAAAAAAGG - Intergenic
1169998295 20:11584296-11584318 CGGTTGCTATTGATAATAAATGG + Intergenic
1173038569 20:39436528-39436550 GGGGGGTTAAGGATGAAAAATGG - Intergenic
1173156302 20:40613724-40613746 AAATGGTTATTGATGAAAAAGGG - Intergenic
1174687510 20:52469802-52469824 GGCCTGTTCGTGATGAAAAAAGG + Intergenic
1175884778 20:62283517-62283539 GGGTTGTTATTGATGAAAAAAGG + Intronic
1176328602 21:5524829-5524851 GGGTTCTTATTTATACAAAATGG - Intergenic
1176399155 21:6296122-6296144 GGGTTCTTATTTATACAAAATGG + Intergenic
1176438002 21:6692982-6693004 GGGTTCTTATTTATACAAAATGG - Intergenic
1176462264 21:7020052-7020074 GGGTTCTTATTTATACAAAATGG - Intergenic
1176485825 21:7401830-7401852 GGGTTCTTATTTATACAAAATGG - Intergenic
1176919074 21:14664615-14664637 GGGTAATTATTGAAGAAAAAAGG + Intergenic
1177731261 21:25029084-25029106 GGGTGGGAATTGATGAGAAAGGG + Intergenic
1178036117 21:28584789-28584811 AGGGTGAAATTGATGAAAAAGGG + Intergenic
1181893323 22:26084191-26084213 GGGTTGTCATTCATGAGACATGG + Intergenic
1184001395 22:41676599-41676621 GGGTTTGAATTGAAGAAAAAAGG + Intronic
951113949 3:18837894-18837916 GCGTTTTTATTGATGTAAGATGG - Intergenic
956433761 3:69213253-69213275 TGGTTGTCATGGAGGAAAAATGG + Intronic
957821418 3:85379736-85379758 GTATTTTTGTTGATGAAAAAAGG - Intronic
961988540 3:131162764-131162786 AGGTTATTAGTGATGAAAATAGG + Intronic
963516368 3:146314489-146314511 AGGTTGTTATTGATAAGTAAGGG + Intergenic
964306019 3:155340785-155340807 GTGTTATTATTGATTAAAATGGG - Intergenic
964385521 3:156143470-156143492 AGGTTGTTATTAAAGAAATAAGG + Intronic
965169727 3:165247461-165247483 GGGTAATTTATGATGAAAAAAGG + Intergenic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
969354409 4:6616949-6616971 GGGTAGTTTATGAAGAAAAAAGG + Intronic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
971232250 4:24809187-24809209 GGCTTGTTAGTAATGAAAAAAGG + Intronic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
972115030 4:35620964-35620986 GGGTACTTATTCATTAAAAATGG - Intergenic
974053407 4:56962166-56962188 GGGTTTTTATTAAGGAAAAATGG - Intergenic
974335396 4:60537490-60537512 GGGTTAATAATGTTGAAAAAGGG + Intergenic
974429959 4:61783366-61783388 AGGTTATTTTTAATGAAAAAAGG + Intronic
974886796 4:67829145-67829167 CAGTACTTATTGATGAAAAATGG - Intronic
975796241 4:78009476-78009498 TGGTTTTCATTGATGAGAAAAGG - Intergenic
976839455 4:89414193-89414215 GGGTTGATATGGATGCAGAACGG + Intergenic
978053978 4:104239823-104239845 GGATGGTTATTGGTGAATAATGG + Intergenic
979927005 4:126580388-126580410 AGGTTGTTAATGAAGAAAAAGGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980737631 4:136911922-136911944 GGCTTGCTATAGATGAGAAAGGG - Intergenic
981928297 4:150163459-150163481 TAGTAGTTATTGAAGAAAAAAGG - Intronic
982886892 4:160792549-160792571 GGGTTTATAATGCTGAAAAAAGG + Intergenic
983300319 4:165916882-165916904 GTATTATTAATGATGAAAAAAGG + Intronic
983790518 4:171792041-171792063 GGCCTTTTATTGATGAAAAAGGG - Intergenic
985486635 5:155613-155635 GGGATGTTTTTGGTGACAAAGGG - Intronic
987662218 5:20891558-20891580 GGGGAGTTTTTGATGAAAATTGG + Intergenic
988761364 5:34313756-34313778 GGGGAGTTTTTGATGAAAATTGG - Intergenic
991726529 5:69541197-69541219 GGGTGGGTATTGATGGAGAAAGG - Intronic
991868428 5:71086677-71086699 GGGTGGGTATTGATGGAGAAAGG + Intergenic
992897082 5:81254740-81254762 GGGTGGTTTGGGATGAAAAAGGG - Intronic
993224792 5:85154309-85154331 GTGTTTTTATTGATGATAGAAGG + Intergenic
993280698 5:85921157-85921179 GGGCTCTTCTTGATGAAAAGTGG - Intergenic
994035441 5:95194863-95194885 GGGTGGTCATTGATCAAACAAGG + Intronic
994779437 5:104070512-104070534 GGGTGGTTATAGCTTAAAAATGG - Intergenic
995970150 5:117959054-117959076 TTGTTGTTATTGTTGAAAACTGG - Intergenic
1000866276 5:166518674-166518696 AAGTGGCTATTGATGAAAAAGGG + Intergenic
1000927330 5:167209864-167209886 GGGTTGATATAGTTGAATAAGGG - Intergenic
1005297968 6:24445409-24445431 AGAATGTTATTAATGAAAAAAGG + Intronic
1006583893 6:35092865-35092887 GGGTTGTTACTACTGAAAATTGG + Intergenic
1008076722 6:47153299-47153321 TGTTTGTTATTGATGATAAATGG - Intergenic
1009385517 6:63081210-63081232 GGGTGGTTAATGATGGAAGAGGG - Intergenic
1010002477 6:70961742-70961764 GGGTTGTAATTGTTGAAACTAGG + Intergenic
1010500167 6:76589437-76589459 GTGTTGTGATTGATTAAAACAGG + Intergenic
1011033445 6:82947047-82947069 GTGTTGTTATTGATAAGTAAAGG - Intronic
1012041266 6:94206880-94206902 GCTTTGTTATTGATTATAAATGG + Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1013503961 6:110780542-110780564 GGTTTGTTTTGGAAGAAAAATGG - Intronic
1014756307 6:125305047-125305069 GGGTTCTTAAAGATGGAAAAGGG + Intergenic
1014775044 6:125498854-125498876 GGGTTGTGGTTGATGAAGAATGG + Intergenic
1018413359 6:163579165-163579187 GGCTGGGTAATGATGAAAAAAGG + Intergenic
1020790000 7:12615539-12615561 GGGTAATTAATGAAGAAAAAAGG - Intronic
1021327054 7:19285600-19285622 TGTTTGTAATTGATGAAATATGG - Intergenic
1021780242 7:24098393-24098415 AGGTTATTATTGATAAATAAAGG + Intergenic
1022179407 7:27903917-27903939 AGCTTGTTTTTGCTGAAAAATGG - Intronic
1023026688 7:36057187-36057209 GGGATTTTATTGTTGTAAAAGGG + Intergenic
1025113519 7:56238817-56238839 GGGGGGTTGTTGATGGAAAAAGG + Intergenic
1026243223 7:68595291-68595313 GAGTTGCTGTTGATGAAAATGGG - Intergenic
1027484114 7:78738668-78738690 AGGATGTTCATGATGAAAAAAGG + Intronic
1027756142 7:82214274-82214296 GGGTTGTAATAGATTAAGAAAGG - Intronic
1027979056 7:85193831-85193853 TTGTTGTTATTGTTGAAAGATGG - Intergenic
1028239967 7:88407899-88407921 GTGTTCTCGTTGATGAAAAAAGG + Intergenic
1028959091 7:96728716-96728738 GCGTTGTTATTGATTAATTATGG - Intergenic
1030651281 7:112118855-112118877 GGGTGGTTATTGAAGAAACTGGG - Intronic
1035273656 7:157734507-157734529 GGTTTGTAATGGATGGAAAAAGG + Intronic
1039152694 8:34524958-34524980 GGCTTGGTATAGATGTAAAAGGG + Intergenic
1040425802 8:47284871-47284893 GGGTTATTAGTAATGAAGAAGGG + Intronic
1040806221 8:51399229-51399251 GGTTTTTTATTCAAGAAAAATGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040938460 8:52806870-52806892 GGGTTTCTATTGATGTTAAAGGG + Intergenic
1041354187 8:56982736-56982758 GGGTTATTCTTTAAGAAAAAGGG + Intronic
1041569182 8:59317306-59317328 GGGTTGTACATGATGAAAATTGG - Intergenic
1042062872 8:64840235-64840257 GGGTTCTTATAAATGAAAGAGGG + Intergenic
1042156112 8:65845807-65845829 TTGTTGTTATTGCTGAAAATTGG + Intergenic
1042873465 8:73419114-73419136 GAGATCTTTTTGATGAAAAATGG - Intergenic
1043050121 8:75376184-75376206 GCCTTGTTTTTGAGGAAAAATGG + Intergenic
1048141590 8:131800128-131800150 GGGTTTTTAATGAAGAAGAATGG - Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051394263 9:16602219-16602241 GGTTTCTTATTTAAGAAAAAAGG + Intronic
1052561954 9:30095154-30095176 GAGTCCTTATTAATGAAAAAAGG - Intergenic
1053338336 9:37299088-37299110 GGGTTGTTCTTGCTGATAACTGG - Intronic
1056788503 9:89610322-89610344 AGGGTGTTTTTGATGCAAAAAGG - Intergenic
1057132177 9:92661757-92661779 GTTTTGGTATTGATGAAAACTGG - Intronic
1058671602 9:107364987-107365009 GAGTTGTTGCTGATGGAAAAAGG + Intergenic
1203433507 Un_GL000195v1:115639-115661 GGGTTCTTATTTATACAAAATGG + Intergenic
1186215152 X:7291931-7291953 TGGTTGTTACTGATGAAACTTGG - Intronic
1186546359 X:10454018-10454040 TGCTTGCTATTGATCAAAAAGGG - Intronic
1187736520 X:22310557-22310579 GGATTCATATGGATGAAAAAAGG + Intergenic
1188947472 X:36324674-36324696 GGATTATTATAGATGAAAATAGG + Intronic
1189555050 X:42134646-42134668 GAGTGCTTATTCATGAAAAATGG + Intergenic
1189648173 X:43157387-43157409 GTGTTGTGATTGATGCAAAGAGG - Intergenic
1194470798 X:94293554-94293576 GGGTTGCTTTGGAAGAAAAAAGG + Intergenic
1196739558 X:119012633-119012655 GGGTTGTTATTAATATAAAAGGG - Intronic
1199302182 X:146225847-146225869 GCTTTATTATTGATGAGAAAGGG + Intergenic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic