ID: 1175884927

View in Genome Browser
Species Human (GRCh38)
Location 20:62284394-62284416
Sequence CAACAGAGGGAGACCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 4, 2: 42, 3: 157, 4: 697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175884927_1175884932 -3 Left 1175884927 20:62284394-62284416 CCAGGCAGGGTCTCCCTCTGTTG 0: 1
1: 4
2: 42
3: 157
4: 697
Right 1175884932 20:62284414-62284436 TTGCCCAGGCTGGAGTACAGTGG 0: 5271
1: 80003
2: 189475
3: 231508
4: 183107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175884927 Original CRISPR CAACAGAGGGAGACCCTGCC TGG (reversed) Intronic
900141803 1:1141821-1141843 CGACCGGGGGAGACCCTGCATGG + Intergenic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900621823 1:3591049-3591071 CCACAGAGGCAGAGCCTCCCAGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901650635 1:10740936-10740958 CGACAGGGTGAGACCCTGTCTGG + Intronic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902807971 1:18872573-18872595 GGGCAGAGGGAGAACCTGCCAGG + Exonic
902854527 1:19191259-19191281 CAAGAGTTCGAGACCCTGCCTGG + Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903303839 1:22398475-22398497 TGACAGAGTGAGACCCTGTCTGG + Intergenic
903775658 1:25791865-25791887 CAGCAGAAGGTGACCCAGCCAGG - Intergenic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904369624 1:30040198-30040220 AAGCAGAGGGAGGCCCTGACAGG + Intergenic
904489119 1:30847490-30847512 CAAGAGAGTGAGTCCCTTCCTGG + Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905376034 1:37520866-37520888 CAACAGAGAGAGATCCTGGGAGG + Intergenic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906033232 1:42736221-42736243 CCACACAGGGTGACCCGGCCTGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908648817 1:66309938-66309960 AAACAGTGGGAGAGCCTGGCAGG - Intronic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
911080437 1:93923808-93923830 TGACAGAGTGAGACCCTGTCTGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913468117 1:119163940-119163962 CAGCAGATTGAGACCATGCCGGG - Intergenic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914361075 1:146936944-146936966 CAAGAGAGGAAGACCGAGCCAGG - Intergenic
914413499 1:147455385-147455407 CAACAGAGCAAAACCCTGTCTGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
914949356 1:152098668-152098690 AAACAGAGTGAGACCCAACCAGG - Intergenic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915338477 1:155162507-155162529 CTACAGAGGAAGACTCTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915441040 1:155945677-155945699 TGACAGAGCAAGACCCTGCCTGG - Intergenic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
916778904 1:168001270-168001292 GAAGAGTGTGAGACCCTGCCTGG + Intronic
917203719 1:172545949-172545971 GGACAGAGCAAGACCCTGCCAGG - Intronic
917289354 1:173456417-173456439 CAACGGAGTGAGAACCTGACTGG - Intergenic
917910293 1:179637693-179637715 CAACAGAGTAAGGCCCTGTCTGG + Intronic
917938044 1:179888433-179888455 CAACATACTGAGACCCTGTCTGG - Intronic
918025379 1:180739758-180739780 AAACATAGTGAGACCCTGTCTGG - Intronic
918115245 1:181490504-181490526 CTTCAGAGAGAGGCCCTGCCTGG + Intronic
918833191 1:189425202-189425224 CTACAGAGAGAGAGCCTGTCTGG - Intergenic
918943431 1:191029517-191029539 TGACAGAGGGAGACTCTGTCAGG + Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920505645 1:206513541-206513563 AGACAGAGCGAGACCCTGCAGGG - Intronic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922571137 1:226635238-226635260 CGACAGAGTAAGACCCTGTCTGG - Intronic
922643291 1:227258153-227258175 CAACAGGGTGAAACCCTGTCCGG + Intronic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924213202 1:241791650-241791672 CGAAAGAGTGAGACCCTGTCTGG + Intronic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063013665 10:2052252-2052274 TAACAGATGGAGACGCGGCCAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063186770 10:3658919-3658941 CTACAGAGGAAGGCCCAGCCAGG - Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1063670729 10:8097695-8097717 CAACAGACGGCGACCCCACCAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064113010 10:12554557-12554579 CAACAGAGCAAGATCCTGCCTGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064546288 10:16453099-16453121 CAACACAGTGAGACCCCACCTGG - Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064997167 10:21306436-21306458 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1065164496 10:22960900-22960922 CAACAGAGGGAGAGCTTGCTGGG - Intronic
1065715232 10:28560339-28560361 CAACAAAGCGAGATCCTGTCGGG + Intronic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1066467388 10:35665354-35665376 TGAAAGAGTGAGACCCTGCCTGG - Intergenic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1067539397 10:47140820-47140842 GAGCAGAGGGAGCCCCAGCCTGG + Intergenic
1067581611 10:47450015-47450037 CAACAGAAAGAGACCCCGACGGG - Intergenic
1067815283 10:49470473-49470495 CAAAAGAGAAAGACCCAGCCAGG - Exonic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069058619 10:63870655-63870677 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070212886 10:74345320-74345342 CAACAAAGCAAGACCCTGTCTGG - Intronic
1070298549 10:75185951-75185973 CATCAGATGAGGACCCTGCCTGG + Intergenic
1070306576 10:75243165-75243187 CAACAGAGGGAGACTCCATCTGG - Intergenic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071831915 10:89380453-89380475 TGACAGAGGGAGGCCCTGTCTGG - Intronic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072062960 10:91835307-91835329 CGACAGTGCGAGACCCTGCTTGG - Intronic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072171391 10:92865515-92865537 CGACAGAGGGAGACGCCTCCCGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1074347051 10:112697211-112697233 TAACAGAGCAAGACCCTGTCTGG - Intronic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1075387964 10:122070902-122070924 TAGCAGAGGAAGACCCTGTCTGG + Intronic
1075488826 10:122848731-122848753 TAACACAGGGAGGTCCTGCCTGG + Intronic
1076218560 10:128715419-128715441 CAGCAGGGGGTGGCCCTGCCTGG + Intergenic
1077305353 11:1866496-1866518 TGACAGCCGGAGACCCTGCCAGG - Exonic
1077616773 11:3681057-3681079 CAACACCGTGAGACCCTGTCTGG - Intronic
1078123698 11:8537273-8537295 CCACATAGCAAGACCCTGCCAGG - Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078245137 11:9567494-9567516 CAACAGAGCAACACCCTGTCTGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1079134108 11:17766529-17766551 CAGCAGAGGGACCCTCTGCCTGG - Intronic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1080409915 11:32013858-32013880 CCACAGAGTGAGATACTGCCTGG - Intronic
1081881983 11:46461221-46461243 TGACAGAGGAAGACCCTGACTGG + Intronic
1081917915 11:46745655-46745677 CAACAAAAAGAGACCCTGGCTGG + Intronic
1082859222 11:57838059-57838081 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1083766324 11:64843240-64843262 CAACAGAGGGCCCCCATGCCGGG + Intronic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084119477 11:67060399-67060421 GGACAGAGGGTGACCCTGCCTGG + Intronic
1084867195 11:72068599-72068621 TGACAGAGAGAGACCCTGTCTGG + Intronic
1085030547 11:73268602-73268624 TGACAGAGTGAGACCCTGTCTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1085767903 11:79299477-79299499 CAAAAGAGGATGACCCTGCCTGG - Intronic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088297312 11:108314133-108314155 CAACAGAGCCAGATCCTGTCTGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088578728 11:111297373-111297395 CCACAGAGGGAGAGAGTGCCAGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1088814688 11:113412988-113413010 CACCACAGGGTCACCCTGCCAGG + Intronic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1089328713 11:117675315-117675337 CAACAGAGCGAGATCCTGGCTGG - Intronic
1089597630 11:119591279-119591301 CAGAAGAGGGAGCCTCTGCCAGG + Intergenic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090321175 11:125844905-125844927 TACCATAGGGAGGCCCTGCCTGG - Intergenic
1090456060 11:126850653-126850675 CAACAGAGGAAGACTTTACCAGG + Intronic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091232224 11:133996076-133996098 TAACAGACTGAGACCCTGTCTGG + Intergenic
1091702102 12:2670286-2670308 CAACAGAAGGAGCCCCGGGCAGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092466715 12:8739925-8739947 TGACAGAGCGAGACCCTGTCTGG - Intronic
1092500227 12:9038239-9038261 CAACTGAGCAAGACCCTGCAAGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092851780 12:12635347-12635369 TGACAGAGTGAGACCCTGTCTGG + Intronic
1093398957 12:18719359-18719381 CTACTGAGGTAGACACTGCCAGG + Intronic
1093470949 12:19501615-19501637 CTACAAAGTGAGACCCTGTCTGG + Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1095246263 12:39926633-39926655 TGACAGACTGAGACCCTGCCTGG - Intronic
1096162230 12:49388391-49388413 TGACAGAGAGAGACCCTGTCAGG - Intronic
1096211253 12:49767618-49767640 CAACAGCAGGAGACACAGCCTGG + Intergenic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096516746 12:52160314-52160336 CACCAGAGAGAGTTCCTGCCAGG - Intergenic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096681473 12:53258269-53258291 CGACAGAGGGAGACTCCACCTGG + Intergenic
1096940225 12:55336238-55336260 GAACAGAGTCAGACCCTGCCTGG - Intergenic
1097018215 12:56002166-56002188 CAAGATAGGGAGACCCTGGGAGG - Exonic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1100222797 12:92524114-92524136 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1100625516 12:96327565-96327587 CAACAGAGCAAGACCCTGCCTGG - Intronic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101502489 12:105317008-105317030 CAACATAGGAAGACCCTGTGAGG + Intronic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1103556476 12:121769681-121769703 TGACAGAGTGAGACCCTGCCTGG + Intronic
1104248780 12:127069514-127069536 CAACAGAGCAAGACCCAGCTTGG - Intergenic
1104462712 12:128968706-128968728 CAGCATAGGGACAGCCTGCCTGG + Intronic
1104598075 12:130133446-130133468 CACCTGAGTGAGACTCTGCCAGG + Intergenic
1104839405 12:131814703-131814725 CAACATATTGAGACCCTGTCTGG + Intergenic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1107917203 13:45164704-45164726 TGACAGAGTGAGACCCTGTCTGG + Intronic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1110441760 13:75533987-75534009 CAACAGACTGAGATCCTGTCTGG - Intronic
1110566574 13:76963405-76963427 CAACAAAGTAAGACCCTGTCTGG + Intergenic
1110773283 13:79376217-79376239 CAACTGAGCAAGACCCTGTCTGG - Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111703970 13:91724835-91724857 CGACAGAGTGAGATCCTGTCTGG + Intronic
1111768965 13:92572013-92572035 CAACAGAATGAGCCCCTGTCTGG + Intronic
1111929798 13:94501943-94501965 AAACAGTGGGAGACCCAGCAAGG - Intergenic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1112798547 13:103084713-103084735 CATCATAGCAAGACCCTGCCTGG - Intergenic
1113016343 13:105832601-105832623 CAGCAGAGAGAGAGCCTACCAGG + Intergenic
1113119913 13:106915081-106915103 TGACAGAGCGAGACCCTGTCTGG + Intergenic
1113179166 13:107605909-107605931 AAACACAGGTAGACCCAGCCAGG + Intronic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113450612 13:110406950-110406972 CAGGAGCAGGAGACCCTGCCGGG - Intronic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1114175830 14:20318780-20318802 CGACAGAGTGAGACCCTATCTGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1115233060 14:31182208-31182230 CGACAGAGCAAGACCCTGTCTGG - Intronic
1115273794 14:31584163-31584185 CAACAAAGCAAGACCCTGTCAGG - Intronic
1115632569 14:35260029-35260051 CAACAGAGTGAAACCCTATCTGG - Intronic
1115635025 14:35282861-35282883 CAACAGAGTGAGACCCCACAGGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116461505 14:45180464-45180486 TGACAAAGCGAGACCCTGCCTGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117304133 14:54457094-54457116 CAACAGAGCAAAACCCTGTCTGG + Intergenic
1117361245 14:54976380-54976402 CAACATAGAGAGACCCTGCCAGG - Intronic
1118110037 14:62708282-62708304 CAACACAGGGTGACCCTGAGAGG - Exonic
1118163724 14:63316021-63316043 GAACAGGGAGAGGCCCTGCCAGG + Intronic
1118181533 14:63498575-63498597 TGACAGAGTGAGACCCTGTCTGG - Intronic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118752924 14:68819597-68819619 CTTCAGAGGGAGCCCCTCCCTGG + Intergenic
1119054716 14:71407524-71407546 CAACAAAGTGAGACCCTGGGAGG - Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119933048 14:78566575-78566597 CCACAGAGCCAGACCCTACCAGG + Intronic
1121139135 14:91525551-91525573 AGACAGAGTGAGAACCTGCCTGG - Intergenic
1122058436 14:99120882-99120904 CAACATAGAGAAACCCTGTCAGG + Intergenic
1122085564 14:99299562-99299584 AAAAAGAGTGAGACCCTGTCTGG + Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122672298 14:103382132-103382154 CAAGAGAGCAAGACCCTGTCTGG + Intergenic
1122954065 14:105061690-105061712 CAACACAGGAAGCCTCTGCCTGG - Intronic
1123058630 14:105584354-105584376 CAACACAGCAAGAGCCTGCCAGG + Intergenic
1123082961 14:105704588-105704610 CAACACAGCAAGAGCCTGCCAGG + Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126030422 15:44491859-44491881 CAAAAGAGCCAGACCCTGTCTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126355367 15:47789615-47789637 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1126766124 15:52012965-52012987 CGACAGAGTGAGACTCCGCCTGG + Intronic
1127429263 15:58886284-58886306 CTACAGAGCCAGACCCTGTCTGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1129074354 15:72978933-72978955 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129661598 15:77555925-77555947 CCACTCAGGGAGACCCAGCCAGG + Intergenic
1130111815 15:80971644-80971666 GGACAGAGTGAGACCCTGGCTGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1130525704 15:84704548-84704570 CAACAGAGGGCTTCCCTTCCTGG + Intronic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131949764 15:97669352-97669374 CAACAGAGCAAGACCCTGACTGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132181603 15:99757615-99757637 CAACAGAGTGAACCCCTGTCTGG - Intergenic
1132276767 15:100573136-100573158 CAACAGATGGAGATCCTTTCAGG - Intronic
1132521533 16:392288-392310 CAACAGGGCGAGACCCGGTCTGG - Intergenic
1132771264 16:1564778-1564800 CTGCAGAGTGGGACCCTGCCGGG + Intronic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1134154947 16:11835511-11835533 CAACAGAGAGAGACAGTCCCTGG - Exonic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134493950 16:14717424-14717446 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134499330 16:14756548-14756570 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134546526 16:15113188-15113210 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134547011 16:15117671-15117693 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134568320 16:15270066-15270088 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1134581239 16:15372463-15372485 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134713461 16:16341662-16341684 CAACAGAGGGAGACTCCTCTTGG - Intergenic
1134721331 16:16385020-16385042 CAACAGAGGGAGACTCCTCTTGG - Intronic
1134734111 16:16486294-16486316 TGACAGAGTGAGACCCTGGCAGG - Intergenic
1134744501 16:16577335-16577357 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1134933388 16:18225987-18226009 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1134946095 16:18326864-18326886 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134953358 16:18367008-18367030 CAACAGAGGGAGACTCCTCTTGG + Intergenic
1135000986 16:18776417-18776439 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1135035496 16:19073471-19073493 TGACAGAGTGAGACCCTGTCTGG + Intronic
1135108015 16:19667712-19667734 CGACAGAGCAAGACCCTGTCTGG + Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136151318 16:28351623-28351645 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136167550 16:28465463-28465485 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136195427 16:28649555-28649577 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136211765 16:28763671-28763693 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136256485 16:29043617-29043639 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137794403 16:51203129-51203151 CTATAGAGTGAGACCCTGTCAGG - Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139849947 16:69945103-69945125 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139878934 16:70168011-70168033 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140373584 16:74427482-74427504 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1140405375 16:74707103-74707125 CAATAGAGCAAGACCTTGCCTGG - Intergenic
1140434810 16:74937956-74937978 CGACAGAGCGAGACCCAGCATGG - Intronic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140503053 16:75451528-75451550 TGACATAGGGAGACCCTGTCTGG + Intronic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1141147298 16:81540320-81540342 CAACAAAGTGAGACTCAGCCAGG - Intronic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1142412053 16:89921868-89921890 CAGCAGAGGCGGGCCCTGCCAGG - Intronic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142606046 17:1081595-1081617 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142750468 17:1984381-1984403 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142846519 17:2681483-2681505 TGACAGAGCAAGACCCTGCCCGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1143780323 17:9225731-9225753 CCTCCGAGGGAGCCCCTGCCCGG - Intronic
1144433174 17:15213873-15213895 CAGCAGGGGGAGCCCCTGCTTGG - Intergenic
1144943530 17:18958088-18958110 CAACAGAGTGAAATCCTGTCTGG - Intronic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146245837 17:31282038-31282060 CAATGGAGAGAGACCCTGTCTGG + Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147340001 17:39747605-39747627 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1147621033 17:41866834-41866856 CGACAGAGTGATACCCTGTCTGG + Intergenic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147742652 17:42677603-42677625 CAAGACAGCGAGACCCTGTCTGG - Intergenic
1148324815 17:46777052-46777074 AAACAGAGGCCGACCATGCCAGG + Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148677159 17:49452125-49452147 CAGGAGAAGCAGACCCTGCCAGG - Intronic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150570841 17:66385674-66385696 CAACACAGCGAGACTCTTCCTGG + Intronic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151289496 17:73139251-73139273 CAACAGAGTGAGACTCCGCATGG + Intergenic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1151956200 17:77381382-77381404 GGACAGAAGGAGATCCTGCCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1152519366 17:80846290-80846312 CCAAAGAGGGAGAGCCTGCGGGG - Intronic
1152587749 17:81196599-81196621 CAACAGAGGAAGAAGCTCCCTGG + Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1154182988 18:12153570-12153592 TGACAGAGCGAGACTCTGCCTGG + Intergenic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1155035808 18:22023943-22023965 CAACAGAGCGACACCCTGCCAGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155501613 18:26492220-26492242 CAATAGAGTGAGACCCTATCTGG + Intronic
1155953048 18:31933907-31933929 CAACAGTGAGACACCATGCCCGG - Intronic
1155955310 18:31951902-31951924 CGACAGAGTGAGACCCCGTCTGG + Intronic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156968339 18:43124043-43124065 TAACAGAATGAGACCCTGTCTGG - Intergenic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158676968 18:59529178-59529200 CCCCACAGGGAGGCCCTGCCCGG + Intronic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161307469 19:3576034-3576056 CCACGGAGGGAGGCCCTGCCTGG - Intronic
1161439655 19:4283596-4283618 CGACAGAGTGAGACTCCGCCTGG - Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161682937 19:5689209-5689231 CGACAGAGCAAGACCCTGTCTGG + Intronic
1161716439 19:5878708-5878730 CGACAGAGGGAGACTCCGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1162073150 19:8167026-8167048 CAAAAGAGCAAGACCCGGCCGGG - Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162664342 19:12196899-12196921 GCACAGAGTGAGACTCTGCCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163514977 19:17757312-17757334 CAAGAGAGGCAGACGCTGCTGGG + Intronic
1163582395 19:18146425-18146447 ACACAGAGTGAGACCCTCCCTGG + Intronic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163879411 19:19904037-19904059 CAACAGAGCGAGATTCTGGCTGG + Intronic
1164454393 19:28395229-28395251 CACCAGAGCAAGACCCAGCCTGG + Intergenic
1164921645 19:32092915-32092937 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165643219 19:37408004-37408026 GAACTGATAGAGACCCTGCCAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166189799 19:41168766-41168788 CAACAGAGCAAGACCCTTTCTGG - Intergenic
1166270738 19:41711925-41711947 GCACAGATGGAGCCCCTGCCAGG + Intronic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166900190 19:46055275-46055297 CAACACAGTGAGACCCTATCTGG - Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167281011 19:48568580-48568602 CAAGTGAGGGAGAGCCTGGCGGG + Intronic
1167450635 19:49566484-49566506 CAACATAGCAAGACCCTGCCTGG - Intronic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167996007 19:53402747-53402769 CAACACAGCAAGACCCTGTCTGG - Intronic
1168001493 19:53449875-53449897 CAACACAGCAAGACCCTGTCTGG - Intronic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168708538 19:58483628-58483650 CAACAGGATGAGACCCTGTCTGG + Intronic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926758100 2:16252109-16252131 CCACGGAGGGTCACCCTGCCGGG + Intergenic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927782508 2:25951143-25951165 CAACAGAGTGAGGCCTTGCCCGG - Intronic
927930037 2:27038113-27038135 CGACAGAGGGAGAGGCTGCTGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928141239 2:28731222-28731244 CGACAGAGTAAGACCCTGCCAGG - Intergenic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
929555680 2:42924358-42924380 CCTCAAAGGGAGACCCTCCCAGG - Intergenic
929712736 2:44281176-44281198 AGACAGAGCAAGACCCTGCCTGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930059986 2:47280288-47280310 TGACAGAGCGAGACCCTGTCTGG - Intergenic
930110462 2:47674691-47674713 TGACAGAGTGAGACCCTGTCTGG + Intergenic
930479224 2:51926130-51926152 CAATAGAGGGAGGGGCTGCCTGG + Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932507213 2:72246661-72246683 AAACACAGTGAGACCCTGCATGG - Intronic
932559278 2:72852909-72852931 TGACAGAGTGAGACCCTGTCTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
934766436 2:96882676-96882698 CGCCAGAGGGAGGCCCTTCCAGG + Intronic
934924111 2:98369814-98369836 CAGCAGAGGGTGTGCCTGCCAGG + Intronic
935265998 2:101394808-101394830 CCACAGAGCGAGGCCCTGTCCGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937345878 2:121124986-121125008 CACCAGAGGAGGACCCTGCATGG + Intergenic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938342046 2:130542049-130542071 CAACAGAGGGAGAGGAGGCCGGG + Intronic
938347786 2:130578662-130578684 CAACAGAGGGAGAGGAGGCCGGG - Intronic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
939200763 2:139031237-139031259 CAACCCAGGGAAACCATGCCTGG - Intergenic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942147447 2:173040506-173040528 CCCCAGAAGGAGCCCCTGCCAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945094765 2:206208657-206208679 TGACAGAGTGAGACCCTGCCTGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945511770 2:210712131-210712153 CAACAGAGTGAGACACCACCTGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946231426 2:218293603-218293625 TGACAGAGCGAGACCCTGTCTGG - Intronic
947205176 2:227654293-227654315 CGACAGAGCAAGACTCTGCCTGG + Intergenic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947562918 2:231173504-231173526 CAACAGGGCAAGACCCTGTCTGG + Intergenic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947839834 2:233200593-233200615 ATCCAGAGGAAGACCCTGCCAGG - Intronic
948212897 2:236208193-236208215 CCACAGAGGGAGTGCCTGGCAGG + Intronic
948589160 2:239038491-239038513 GAACAGAGGCAGCCCCGGCCCGG - Intergenic
948615636 2:239196960-239196982 AGACAGAGGGAGCGCCTGCCCGG - Intronic
948871015 2:240798114-240798136 CCACAGGGGAAGACCCTTCCTGG - Intronic
949004988 2:241640687-241640709 CTTCAGAGTGAGACCCTTCCTGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169246166 20:4026961-4026983 CTACAGGGCAAGACCCTGCCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1170935287 20:20804591-20804613 CAGCAGAGAGTGACCCAGCCTGG - Intergenic
1171483568 20:25470631-25470653 CAACTCAGGGAGTCCCTGCTTGG + Intronic
1171546508 20:26006117-26006139 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1172159479 20:32856380-32856402 TGACAGAGCGAGACCCTGCCTGG - Intergenic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1172623325 20:36333710-36333732 CAGCAGGGGCAGACCCAGCCAGG - Intronic
1173005151 20:39134564-39134586 AAGCAGAGGGAGCCCCTGTCTGG + Intergenic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173294933 20:41748039-41748061 CCAAACTGGGAGACCCTGCCTGG + Intergenic
1173509130 20:43612400-43612422 CACCAGAGGGAGGCCAGGCCCGG + Intronic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174042968 20:47713019-47713041 TAACAGAGCCAGACCCTGTCTGG + Intronic
1174363677 20:50043740-50043762 CAAAAGAGGCAGAGCCGGCCGGG - Intergenic
1174485745 20:50860114-50860136 CGACAGAGTGAGATCCTGCCTGG + Intronic
1174585767 20:51606876-51606898 AAACAGAGTGAGACCCTGGGTGG - Intronic
1174610376 20:51793439-51793461 TGACAGAGTGAGACCCTGTCTGG + Intronic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175298624 20:57927190-57927212 CAAAAGAGGCTGAGCCTGCCTGG - Intergenic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175761344 20:61563852-61563874 CAACAGGTGCAGAACCTGCCTGG - Intronic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175970003 20:62680922-62680944 TGACAGAGTGAGACCCTGTCTGG - Intronic
1176026904 20:62990436-62990458 CCATAGAGGCAGCCCCTGCCTGG - Intergenic
1176969391 21:15248368-15248390 CAACAGAGTGACATCCTGTCTGG - Intergenic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178614168 21:34116025-34116047 TAACAGAGTGAAACCCTGTCGGG - Intronic
1179457543 21:41509297-41509319 CAACAGAGTGAGACCCCTTCTGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180847041 22:18989198-18989220 CAACAGAGCAAGAACCTGTCTGG + Intergenic
1180915704 22:19484956-19484978 AAACAGAGAGAGACCCCGTCTGG - Intronic
1181474375 22:23159322-23159344 CTACAGAGGGAAACACTGCATGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1182033381 22:27178161-27178183 CAACAGAGTGAGACTCTTCTCGG + Intergenic
1182221646 22:28763466-28763488 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182234795 22:28866760-28866782 TGACAGAGGGAGACCCTGTTAGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182750388 22:32637105-32637127 CTACACAGGGAGTCCCTGCAGGG + Intronic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183793690 22:40097323-40097345 AAACAGAGAAAGACCCTGTCTGG - Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
949993835 3:9601089-9601111 CGACAGTGGGAGAGCCGGCCTGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950082743 3:10235030-10235052 CCACAGAGGGAGAACCTGATTGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
952171120 3:30808010-30808032 CAACAGAGAGAGACCCCTTCGGG + Intronic
952303341 3:32124083-32124105 CTACAGAGGAAGACTCTGTCTGG - Intronic
952368203 3:32693559-32693581 TGACAGAGTGAGACCCTGTCTGG - Intronic
952433352 3:33247505-33247527 AGACAGAGGAAGACCCTGTCTGG - Intergenic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
952828214 3:37541486-37541508 TAACAGAGGTAGATCCTTCCAGG + Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953558250 3:43964036-43964058 CAAGAGAAGAAGACACTGCCTGG + Intergenic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
954388182 3:50255277-50255299 CAGCAGAGGCAGGCCCTGCAGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
956360744 3:68443981-68444003 TAACAAAGTGAGATCCTGCCAGG + Intronic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959944944 3:112116187-112116209 CAACACAGGGGGAGCCCGCCGGG - Intronic
960605380 3:119499111-119499133 CGACAGAGCAAGACCCTGTCTGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961095389 3:124150846-124150868 CAACAGAAAGGGACCCTGCAGGG - Intronic
961143274 3:124573519-124573541 TAATAGAGTGAGACCCTGTCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961597596 3:128030980-128031002 TGACAGAGAGAGACCCTGTCTGG - Intergenic
962864941 3:139440721-139440743 CAACAGAGGGGAAATCTGCCTGG - Intergenic
963623477 3:147641458-147641480 CTACAGAGGGAGGCCATGCTTGG + Intergenic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964621623 3:158724843-158724865 TAACATAGTGAGACCCTGTCTGG - Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966528874 3:180951201-180951223 TGACAGAGTGAGACCCTGTCTGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
967722766 3:192832770-192832792 CAACAGAATGAAACTCTGCCTGG + Intronic
967798957 3:193632836-193632858 CAATAGAGCAAGACCCTGTCTGG + Intronic
967896076 3:194397072-194397094 AACCAGCTGGAGACCCTGCCTGG - Exonic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968888275 4:3348891-3348913 CTGGAGAGGAAGACCCTGCCTGG + Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969311578 4:6355971-6355993 TGACAGAGTGAGACTCTGCCTGG + Intronic
969566578 4:7982210-7982232 CTGCAGAGGGAGCCACTGCCTGG + Intronic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970534890 4:17020808-17020830 CAAAAACTGGAGACCCTGCCTGG + Intergenic
971326496 4:25648546-25648568 CAACACACGGAGAGCCTGCCGGG - Intergenic
971782634 4:31056346-31056368 TGACAGAGAGAGACCCTGACAGG + Intronic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972528578 4:39940197-39940219 TGACAGAGCGAGACCCTGTCTGG + Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973061810 4:45735567-45735589 TGACAGAGTGAGACTCTGCCTGG - Intergenic
973677545 4:53280494-53280516 CGACAGAGGGAAACTCTGTCTGG + Intronic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975181858 4:71355192-71355214 GAATAGAGGGAGGCCCTGCCAGG + Intronic
975512659 4:75210900-75210922 CCACAGAGGGAGAACCTGAGAGG - Intergenic
975581704 4:75912532-75912554 TGACAGAGGGAGACTCTGTCTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977938709 4:102834727-102834749 TGACAGAGTGAGACCCTGTCTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978470553 4:109062406-109062428 CAACAGAGGGAAAACCTTCAAGG + Intronic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
978869567 4:113558819-113558841 TAACATAGTGAGAGCCTGCCAGG + Intronic
978991087 4:115083438-115083460 TGACAGAGGGATACCCTGTCTGG + Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981094510 4:140764412-140764434 TGACAGAGGGAGGCCCTGTCTGG + Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983070324 4:163260059-163260081 AAACAGAGCCAGACCCAGCCTGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984280798 4:177667881-177667903 CGACAGAGGGAGACAGAGCCGGG + Intergenic
984712168 4:182895094-182895116 CAACAGAACGAGACCCAGTCTGG - Intronic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984889176 4:184475699-184475721 CAACAGAGGAAGTTCCTTCCTGG + Intergenic
985774457 5:1833650-1833672 GCACAGAGGCAGACCCTGCAAGG + Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987710674 5:21498149-21498171 CAACAGAACAAGACCCTGTCAGG - Intergenic
988055289 5:26086491-26086513 CAAGAGATGGAGACCATCCCGGG + Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989036089 5:37173488-37173510 CAACATAGTGAGACTCTGCTAGG - Intronic
989042318 5:37241644-37241666 TGACAGAGTGAGACCCTGTCTGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991193341 5:63902082-63902104 TGACAGAGGGAGACTCTGTCTGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991761012 5:69917212-69917234 CAACAGAACAAGACCCTGTCAGG - Intergenic
991786318 5:70200889-70200911 CAACAGAACAAGACCCTGTCAGG + Intergenic
991840241 5:70792263-70792285 CAACAGAACAAGACCCTGTCAGG - Intergenic
991878762 5:71201274-71201296 CAACAGAACAAGACCCTGTCAGG + Intergenic
992560080 5:77942817-77942839 CAATAGAGCAAGACCCTGTCTGG + Intergenic
992821672 5:80504011-80504033 CAAGAGAGGGAGACCTGGCCTGG - Intronic
993330623 5:86595343-86595365 AAACAGAGCAAGACCCTGTCTGG + Intergenic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
994301593 5:98154517-98154539 CAACAGAGCAAGACTCTGACTGG + Intergenic
995146722 5:108795295-108795317 AGCCAGAGGGAGACCCTGTCTGG + Intronic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
996532328 5:124539378-124539400 CCACAGAGAGAGACCTGGCCAGG + Intergenic
997649236 5:135503370-135503392 CCAAAGAGAGAGGCCCTGCCGGG - Intergenic
997958463 5:138299171-138299193 TTACAGAGGGAGACTCTGTCTGG + Intronic
998076792 5:139243149-139243171 CAAAAGAGTGAGACCTTGGCTGG + Intronic
998547998 5:143048143-143048165 CAAAAGAGGAACACACTGCCAGG - Intronic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
999209157 5:149872673-149872695 GTACAGCAGGAGACCCTGCCGGG + Intronic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000625156 5:163529918-163529940 CAACAGACCAAGACCCTGTCTGG + Intergenic
1001472820 5:172026951-172026973 TGACAGAGCGAGACCCTGTCAGG - Intergenic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1005082823 6:21973990-21974012 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005811240 6:29518034-29518056 CATCAGAGTGGGGCCCTGCCTGG - Intergenic
1006259912 6:32859030-32859052 TGACAGAGAGAGACCCTGTCTGG + Intronic
1006548425 6:34799468-34799490 TGACAGAGTGAGACCCTGTCTGG + Intronic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008286552 6:49659365-49659387 TGACACAGTGAGACCCTGCCTGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009017772 6:57923438-57923460 CAACAGAACAAGACCCTGTCAGG + Intergenic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1010214933 6:73393275-73393297 TAACATAGTGAGACCCTGCCGGG - Intronic
1010245051 6:73654508-73654530 CAACAGAGCAAGACCCTGCCTGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1011719900 6:90144523-90144545 CAAAAAAGGGAGATCCTGGCTGG + Intronic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1012505820 6:99944948-99944970 AAGCAGAGGCAGATCCTGCCAGG - Intronic
1013019520 6:106198754-106198776 TGACAGAGCGAGACCCTGTCTGG + Intronic
1013209023 6:107970338-107970360 CCAGAGAGTGAGACCCTGTCTGG - Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1015116353 6:129654021-129654043 TGACAGAGCGAGACCCTGTCTGG + Intronic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016381874 6:143492386-143492408 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1017047217 6:150357954-150357976 CAACTGAGAGAGACACTGGCTGG - Intergenic
1017096560 6:150810287-150810309 TGACAGAGTGAGACCCTGTCTGG - Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017471713 6:154744270-154744292 CAACAGAGCAAGACTCTGGCTGG + Intronic
1017614424 6:156229369-156229391 GAACACAGGGAGAGCCTGCTGGG + Intergenic
1017936527 6:159010345-159010367 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1018086513 6:160305544-160305566 CAACTGAGCAAGACCCTGTCTGG + Intergenic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019666155 7:2253128-2253150 CAACACAGGGAGATGCCGCCAGG + Exonic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019720638 7:2568509-2568531 GAGCAAAGGGAGACCCTGTCTGG - Intronic
1019822621 7:3256861-3256883 CAACAGAGTGAAGCCCTGTCTGG + Intergenic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022099630 7:27161503-27161525 CAACAGAGGGCGTCCCAACCTGG + Intergenic
1023306361 7:38832864-38832886 CAATAGGGAGAGGCCCTGCCTGG - Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023545122 7:41310602-41310624 TGACAGAGGAAGACCCTCCCTGG + Intergenic
1023549686 7:41356675-41356697 AAACGGAGGGAGACCAAGCCAGG + Intergenic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024034374 7:45495162-45495184 CCCCATAGGGAGACCCTGCCCGG + Intergenic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024486014 7:49920573-49920595 GAACAGAGAGAGACTCTGCTTGG + Exonic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1025264101 7:57441138-57441160 TAACAGAGGAGGACCCAGCCTGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026708666 7:72717279-72717301 CAACAGGGCAAGACCCTGTCTGG + Intronic
1026954097 7:74365964-74365986 CAACATAGCGAGACCCTGCCTGG - Intronic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029243009 7:99177845-99177867 CTGCAGAGGGTCACCCTGCCGGG - Intronic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029592957 7:101519468-101519490 CTGCAGAGGGAGAGGCTGCCGGG + Intronic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032521425 7:132548467-132548489 TAACAGTGAGAGACGCTGCCAGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1033873579 7:145786930-145786952 CCACAGAGTGAGTCCCTACCTGG + Intergenic
1033989199 7:147263339-147263361 TGACAGAGGGAGACCCTGCCTGG + Intronic
1034079714 7:148265291-148265313 TGACAGAGTGAGACCCTGTCTGG - Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035232274 7:157472500-157472522 CAGGAGAGGGAGCCCATGCCTGG + Intergenic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1036162727 8:6405102-6405124 CAACGGAGTGAGAAACTGCCTGG + Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1036580120 8:10066170-10066192 CAACATGGGGAAACCCTGCTGGG - Intronic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038631693 8:29251129-29251151 CAACGAGGGGAGACCCTGTCTGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039449939 8:37664693-37664715 CAGCAGAGTGAAACCCTGTCTGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041646940 8:60262662-60262684 CAACATAGTGAGACCCTTTCAGG + Intronic
1042143566 8:65704024-65704046 CAACATAGGGAAACCCTATCTGG + Intronic
1042813516 8:72852238-72852260 TGACAGAGAGAGACCCTGCCTGG + Intronic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043653832 8:82635671-82635693 TGACAGAGGGAGACTCTGTCTGG + Intergenic
1044111428 8:88280055-88280077 CTACAGAGGGAGACTCCGCTTGG - Intronic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044738725 8:95304283-95304305 CAACAGAGAGACAGACTGCCAGG - Intergenic
1044741182 8:95327992-95328014 CAACATAGGGAAATCCTGCCTGG - Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046757878 8:117990200-117990222 GAAGAGAGGGAGACCCAGTCTGG - Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1047744403 8:127833476-127833498 CGACAGAGCAAGACCCTGTCTGG - Intergenic
1048935988 8:139357475-139357497 AAAGAGGGGGAGTCCCTGCCTGG + Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049137554 8:140917320-140917342 CGACAGAGCAAGACTCTGCCAGG + Intronic
1049149788 8:141027183-141027205 CAGCAGAGGGAGACAAGGCCAGG + Intergenic
1049677328 8:143896909-143896931 CAACAGAACAAGACCCTGTCTGG - Intergenic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050601851 9:7260894-7260916 CAACAGAGGAAGACCCTCTTTGG - Intergenic
1051748757 9:20319773-20319795 CCACAGAGGGAGTGCCTGTCTGG - Intergenic
1051755019 9:20389757-20389779 CAACACAGTGAGACCCCGTCCGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1052895957 9:33748652-33748674 CAACAGTGGGATAAACTGCCAGG + Intergenic
1053003131 9:34588843-34588865 CAACACAGGGACACCCAGACTGG + Intronic
1054913916 9:70478770-70478792 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1055886989 9:81075044-81075066 CAAGGGAGGGAGTCCCTTCCTGG + Intergenic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057788307 9:98105081-98105103 AAAAAGATGGGGACCCTGCCAGG - Intronic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059132987 9:111774316-111774338 TGACAGAGTGAGACCCTGTCTGG - Intronic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1061034198 9:128104419-128104441 CAACACAGGGAGGCCCAGCAAGG - Intronic
1061660082 9:132124265-132124287 TAACAGAGTGAGATCCTGTCTGG + Intergenic
1062002359 9:134222846-134222868 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186512471 X:10140258-10140280 TGACAGAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187468493 X:19547133-19547155 CAAAAGAGTGGGACCCTGTCTGG + Intronic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189307527 X:39998006-39998028 CGACAGAAGTAGACCCTGTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190230794 X:48580414-48580436 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190658715 X:52635345-52635367 CACCAGAGGGAGAGGATGCCAGG + Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190677124 X:52791831-52791853 CACCAGAGGGAGAGGATGCCAGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192790105 X:74373194-74373216 CCACAGAGCGAGACCCTGGCTGG + Intergenic
1195511167 X:105716978-105717000 GAACATAGGGAGACCCTGTGTGG + Intronic
1196369308 X:114957878-114957900 CAACAGAGAAAGACCCTGACTGG + Intergenic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197555017 X:127942259-127942281 CAACACAGCAAGACCCTGTCTGG + Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1198021972 X:132667744-132667766 CAACAATGGCAGACCCTACCTGG - Intronic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1201564818 Y:15354866-15354888 CAATAGAGCGAGACTCTGCCCGG + Intergenic
1201728440 Y:17180726-17180748 ATACACTGGGAGACCCTGCCTGG + Intergenic