ID: 1175886092

View in Genome Browser
Species Human (GRCh38)
Location 20:62291802-62291824
Sequence TGTGGTAGCCACGCAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175886086_1175886092 13 Left 1175886086 20:62291766-62291788 CCAAGGAGGAGGCAGAGTGGCAG 0: 1
1: 0
2: 7
3: 71
4: 562
Right 1175886092 20:62291802-62291824 TGTGGTAGCCACGCAGGCTGGGG 0: 1
1: 0
2: 0
3: 46
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175886092 Original CRISPR TGTGGTAGCCACGCAGGCTG GGG Intronic
900487340 1:2929464-2929486 TGTTGAAGCCACCCATGCTGTGG - Intergenic
900532935 1:3163553-3163575 TGTTTCAGCCACTCAGGCTGGGG - Intronic
900609126 1:3537080-3537102 TGTGGGAGCCAGAGAGGCTGTGG + Intronic
900720942 1:4175363-4175385 TGTTGAAGCCACCCAGCCTGTGG + Intergenic
900831814 1:4970929-4970951 TGTCCAAGCCAAGCAGGCTGAGG + Intergenic
901490793 1:9595336-9595358 TGTGAGAGCCAAGGAGGCTGAGG - Intronic
903506590 1:23840016-23840038 TGGCGCAGCCACTCAGGCTGAGG + Intergenic
903573841 1:24325638-24325660 TGTTGGAGCCATGAAGGCTGAGG + Intronic
909265966 1:73558561-73558583 TGTGGAAGTCACCAAGGCTGGGG - Intergenic
910078940 1:83315751-83315773 TGTTCTAGCCACCCAGTCTGTGG + Intergenic
911047561 1:93641082-93641104 TGTGGTAGCCCTGCAGGTTTAGG + Intronic
911232448 1:95375224-95375246 TGTGGAAGCCACCCAGTCTGTGG + Intergenic
911277492 1:95879624-95879646 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
911829926 1:102537272-102537294 TGTGGAAGCCACTAAGGCTTGGG + Intergenic
917134597 1:171777350-171777372 TGGGGTAGGCATGCAGGGTGGGG + Intergenic
919157740 1:193788152-193788174 TGTGTAAGCCACCCAGGCTATGG + Intergenic
923103440 1:230835986-230836008 TGTTGAAGCCACTCAGCCTGAGG + Intergenic
923562944 1:235055331-235055353 TGTTGAAGCCACCCAGGCTGTGG - Intergenic
923890944 1:238214461-238214483 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
924047552 1:240047410-240047432 TGTTTAAGCCACGCAGTCTGTGG + Intronic
924322703 1:242865651-242865673 TGTTGAAGCCACCCAGGCTGTGG + Intergenic
1062791828 10:311552-311574 TGCTGTAGCCTCACAGGCTGTGG - Intronic
1065373303 10:25012095-25012117 TGTGGAAGCCACCAAGGCTTGGG - Intronic
1065455880 10:25906227-25906249 TGTTTAAGCCACGCAGTCTGTGG + Intergenic
1065547548 10:26837156-26837178 TGTTGAAGCCATGCAGTCTGTGG - Intronic
1066454171 10:35558830-35558852 TGTTGAAGCCACCCAGTCTGTGG + Intronic
1067071084 10:43132538-43132560 TGTGGTAGTCACAGTGGCTGGGG - Intergenic
1068305251 10:55199836-55199858 TGTGGAAGCCACTAAGGCTTAGG - Intronic
1068374784 10:56164737-56164759 TGTGGAAGCCACGGAGGGTTGGG - Intergenic
1069963350 10:72092369-72092391 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
1070511092 10:77161277-77161299 TGTGTTTGTCACCCAGGCTGGGG + Intronic
1072806088 10:98424747-98424769 TGGGGTAGCCATGCAGGGGGCGG + Intronic
1073008468 10:100342131-100342153 TGGGGTAGCCTTCCAGGCTGGGG + Intergenic
1076507505 10:130987655-130987677 AGGGGCAGCCACGCAGGCTGGGG - Intergenic
1076782678 10:132732935-132732957 TGTGTAAGCCACCCAGCCTGTGG - Intronic
1078320916 11:10333762-10333784 TGTTTTAGCCACCCAGTCTGTGG + Intronic
1079313101 11:19383532-19383554 TGTGGTAGAGACGCAGACTAAGG - Intronic
1080571616 11:33562426-33562448 TGTTGAAGCCACCCAGTCTGTGG - Intronic
1081045625 11:38269862-38269884 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1083931833 11:65850500-65850522 TGTGGTCTCGACGCAGGGTGGGG - Exonic
1085636270 11:78161712-78161734 TGTTTGAGCCACCCAGGCTGTGG - Intergenic
1085818839 11:79770698-79770720 TGTGGAAGCCATGAAGGCTGGGG - Intergenic
1087157195 11:94916960-94916982 TGTGACAGCCAAGTAGGCTGAGG + Intergenic
1089132805 11:116225348-116225370 TGTAGTAGCCAGGCAGCCTTGGG + Intergenic
1089518834 11:119050435-119050457 GGTGGGAGCCACGCAGCCTCAGG - Intronic
1091293296 11:134454475-134454497 GGAGGTAGCCACCCAGGCTACGG + Intergenic
1093596828 12:20972521-20972543 TGTGGAAGCCTCCAAGGCTGGGG - Intergenic
1095903105 12:47348919-47348941 TGTTGAAGCCACACAGCCTGTGG + Intergenic
1097552710 12:61096735-61096757 TGTTTAAGCCACGCAGCCTGTGG - Intergenic
1097617272 12:61898533-61898555 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1097955805 12:65484189-65484211 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1098509187 12:71291815-71291837 TGTGGAAGCTACCAAGGCTGAGG + Intronic
1098713666 12:73801349-73801371 TGTGGAAGCCACAAAGGCTTAGG - Intergenic
1099905146 12:88762146-88762168 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1101071617 12:101081662-101081684 TGTTGAAGCCACCCAGTCTGTGG - Intronic
1101607237 12:106256807-106256829 TGTGTAAGCCACCCAGCCTGTGG - Intronic
1101805135 12:108056919-108056941 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
1102261289 12:111444992-111445014 GGTGGCAGCCAGGCTGGCTGTGG + Intronic
1102997604 12:117361933-117361955 TGTAGTAGCCACGCAGGGCAGGG + Intronic
1103627110 12:122227593-122227615 TGTGGTGGCGACACAGGCAGAGG - Intronic
1103966159 12:124641102-124641124 TGTTGAAGCCACACAGCCTGTGG - Intergenic
1104843225 12:131834476-131834498 TGTGGATCCCACGCAGGCAGGGG - Intronic
1105265076 13:18808548-18808570 GGTGGTGGTCACTCAGGCTGTGG + Intergenic
1105978339 13:25493654-25493676 TGTGGTAGACATCCAAGCTGGGG + Intronic
1106213415 13:27672285-27672307 TGTTGAAGCCACTCAGGCTGTGG + Intergenic
1106877308 13:34088142-34088164 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1108930122 13:55807412-55807434 TGTGGAAGCCACCAAGGCTTAGG + Intergenic
1111131930 13:83987996-83988018 TGTGAAAGCCACGCATACTGAGG + Intergenic
1111179678 13:84647165-84647187 TATGCTAACCACCCAGGCTGTGG + Intergenic
1111495077 13:89037010-89037032 TGTGAAAGCCTCGCAGACTGTGG - Intergenic
1111997079 13:95175842-95175864 TGTGGAAGCCCCCCAGCCTGTGG + Intronic
1112742967 13:102495652-102495674 TGTGGAAGCCACCAAGGTTGGGG + Intergenic
1113035029 13:106038872-106038894 TGTGGCAGCAAGGAAGGCTGGGG + Intergenic
1114059526 14:19006804-19006826 CGTGGCAGCCACTCGGGCTGTGG - Intergenic
1114059956 14:19009422-19009444 GGTGGCAGACACTCAGGCTGTGG - Intergenic
1114060766 14:19014334-19014356 GGTGGCAGACACTCAGGCTGTGG - Intergenic
1114060956 14:19015493-19015515 GGTGGCAGCCACTCAGGCTGTGG - Intergenic
1114101300 14:19384486-19384508 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1114101488 14:19385646-19385668 GGTGGCAGACACTCAGGCTGTGG + Intergenic
1114102098 14:19389392-19389414 GGTGGCAGACACTCAGGCTGTGG + Intergenic
1114102296 14:19390557-19390579 GGTGGCAGACACTCAGGCTGTGG + Intergenic
1114102588 14:19392329-19392351 GGTGGCAGACACTCAGGCTGTGG + Intergenic
1114103020 14:19394947-19394969 CGTGGCAGCCACTCGGGCTGTGG + Intergenic
1114839749 14:26249184-26249206 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1115740491 14:36382428-36382450 TGTTTAAGCCACCCAGGCTGTGG + Intergenic
1116696392 14:48183296-48183318 TGTGGAAGCCACCGAGGCTTGGG - Intergenic
1116984648 14:51205811-51205833 TGTGGCAGGCAAGAAGGCTGTGG + Intergenic
1118735966 14:68702253-68702275 AGTGGTACCCACGGAGACTGAGG - Intronic
1119353338 14:73984396-73984418 TGTGGTTACCACACAAGCTGTGG + Intronic
1120144648 14:80966748-80966770 TGTGTAAGCCACTCAGTCTGTGG - Intronic
1120289785 14:82553153-82553175 TGTGCAAGCCACCCAGTCTGTGG + Intergenic
1120477535 14:85007382-85007404 TGTGTAAGCCACCCAGTCTGTGG - Intergenic
1120877278 14:89386675-89386697 TGTATGAGCCACGCAGTCTGTGG - Intronic
1121318786 14:92978686-92978708 TGTGGAAGCCACCAAGGCTTGGG - Intronic
1121380810 14:93464224-93464246 TGTTTTAGCCACCCAGTCTGTGG - Intronic
1121482951 14:94292410-94292432 TGTTGGAGCCACCCAGCCTGTGG + Intronic
1122286003 14:100653343-100653365 TGTGGTCCCCACGCAGCCTGTGG + Intergenic
1122646221 14:103196230-103196252 TGTTGAAGCCACCAAGGCTGTGG - Intergenic
1122784123 14:104156046-104156068 TGTGGGTGCCACGCTGGCTGTGG + Intronic
1122993390 14:105249301-105249323 TGTGGCTGACACGCAGCCTGCGG + Intronic
1123068886 14:105631479-105631501 TGTTTAAGCCACGCAGTCTGGGG - Intergenic
1123073042 14:105651437-105651459 TGTTTAAGCCACGCAGTCTGGGG - Intergenic
1123092964 14:105750207-105750229 TGTTTAAGCCACGCAGTCTGGGG - Intergenic
1123098441 14:105777306-105777328 TGTTTAAGCCACGCAGTCTGGGG - Intergenic
1123107501 14:105849552-105849574 TGTTTAAGCCACGCAGTCTGGGG + Intergenic
1202906509 14_GL000194v1_random:76675-76697 GGAGGCAGCCACTCAGGCTGTGG - Intergenic
1123552643 15:21397898-21397920 GGTGGCAGCCACACAGGCTGTGG + Intergenic
1123553280 15:21401728-21401750 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1123588889 15:21835286-21835308 GGTGGCAGCCACACAGGCTGTGG + Intergenic
1123589526 15:21839116-21839138 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1125066104 15:35487456-35487478 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1128063537 15:64750098-64750120 TCTGGGAGCCCCGCTGGCTGAGG - Intronic
1130658963 15:85814897-85814919 TGTGGAAGCCTCACAGGGTGAGG - Intergenic
1130854564 15:87830102-87830124 AGTGGGGGCCACGGAGGCTGAGG - Intergenic
1131063823 15:89420691-89420713 AATGGTACCCAGGCAGGCTGAGG + Intergenic
1131581325 15:93646551-93646573 TGTTGAAGCCACTCAGGCTGTGG - Intergenic
1131799647 15:96055713-96055735 TGTTGAAGCCATCCAGGCTGTGG + Intergenic
1202960992 15_KI270727v1_random:125118-125140 GGTGGCAGCCACACAGGCTGTGG + Intergenic
1202961629 15_KI270727v1_random:128948-128970 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1132751089 16:1458068-1458090 TGTGCTGGCCACGCTGGCGGAGG - Intronic
1132929059 16:2449406-2449428 TGCGGCAGCCAGGCGGGCTGGGG - Exonic
1133264735 16:4576204-4576226 TGTGGCAGCGGCGTAGGCTGCGG - Exonic
1135271844 16:21076413-21076435 TGTGTAAGCCACTCAGTCTGTGG + Intronic
1136139054 16:28277073-28277095 TGGGGTCGTTACGCAGGCTGGGG + Intergenic
1137638552 16:50008726-50008748 TGTGGAAGCCACTAAGGCTTGGG - Intergenic
1140128145 16:72134740-72134762 TGAGGGAGCCACCCAGGCAGAGG - Intronic
1140654395 16:77124580-77124602 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
1141616485 16:85212654-85212676 TGTGTAAGCCACCCAGCCTGTGG + Intergenic
1142984756 17:3689144-3689166 TGTGGCACACAGGCAGGCTGTGG - Intronic
1143716013 17:8769534-8769556 TATGGAAGCCACCCAGTCTGTGG + Intergenic
1144155085 17:12492322-12492344 TGTTTAAGCCATGCAGGCTGTGG + Intergenic
1144211981 17:13023466-13023488 TGGGGAAGCCACTCAGTCTGTGG - Intergenic
1144270048 17:13606776-13606798 TGTGGTAGCCTGGCAGGCGATGG - Intergenic
1146185926 17:30724217-30724239 TGTGTAAGCCGCGCAGTCTGTGG + Intergenic
1146517354 17:33499608-33499630 TGTTGAAGCCACCCAGTCTGTGG + Intronic
1150265716 17:63831265-63831287 CCTGGGTGCCACGCAGGCTGAGG + Intronic
1150454990 17:65300177-65300199 TGTTGAAGCCACCCAGACTGTGG + Intergenic
1150515719 17:65807687-65807709 TGTGGAAGCCACCAAGGCTTGGG - Intronic
1151117708 17:71756515-71756537 TGTTGAAGCCATGCAGTCTGTGG + Intergenic
1151495279 17:74454724-74454746 TGAGGCAGCCACACGGGCTGGGG + Intergenic
1151903231 17:77031520-77031542 TGTGTAAGCCACCCAGCCTGTGG + Intergenic
1152754256 17:82080549-82080571 TGTAGTAGGCAGCCAGGCTGTGG + Exonic
1152771236 17:82170715-82170737 TGTTTAAGCCACTCAGGCTGTGG + Intronic
1154129464 18:11724352-11724374 TGTATAAGCCACGCAGCCTGTGG - Intronic
1154453555 18:14501295-14501317 GGAGGCAGCCACACAGGCTGTGG + Intergenic
1154453967 18:14503845-14503867 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1156122683 18:33863966-33863988 TGTGGAAGCCACAAAGGCTTGGG + Intronic
1157111936 18:44828977-44828999 TGTTTTAGCCACCCAGTCTGTGG + Intronic
1157593736 18:48851341-48851363 AGTGGAAGGCACGCAGGCTGTGG + Intronic
1159651721 18:70986254-70986276 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1160252844 18:77218768-77218790 TCTGGTCCCCACACAGGCTGTGG + Intergenic
1161520741 19:4722460-4722482 TTTGGCAGCCAGGAAGGCTGGGG - Intronic
1161654418 19:5505154-5505176 TGTTTAAGCCACGCAGCCTGTGG + Intergenic
1164961509 19:32434992-32435014 TGTTTAAGCCACGCAGTCTGTGG - Intronic
1166558959 19:43719443-43719465 GGTGGTAGCCACGCAGTGAGTGG - Exonic
1167030255 19:46954203-46954225 TGTTGAAGCCACCCAGTCTGTGG + Intronic
1167741155 19:51325706-51325728 TGGGGAAGTGACGCAGGCTGGGG - Intronic
925451249 2:3971024-3971046 AGTGGGGGCCACGCGGGCTGTGG + Intergenic
926130112 2:10297619-10297641 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
926779966 2:16461602-16461624 TGTGAGAGCCAGGAAGGCTGTGG + Intergenic
927101252 2:19789317-19789339 TGGGGTAGGAAGGCAGGCTGGGG + Intergenic
927302821 2:21535887-21535909 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
927470915 2:23375923-23375945 TGAAGTAGCCTGGCAGGCTGGGG - Intergenic
927660746 2:24990936-24990958 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
928076272 2:28267527-28267549 TGTGTTAGCCACAGAGACTGGGG - Intronic
928712290 2:34020622-34020644 TGTGGAAGCCATGAAGGCAGAGG - Intergenic
929213623 2:39386329-39386351 TGTTGAAGCCACCCAGTCTGTGG + Intronic
929547636 2:42866129-42866151 TGTTGAAGCCACCCAGGCTATGG + Intergenic
929665690 2:43832077-43832099 TGTTGTCGCCCCGCAGGCTCCGG - Exonic
930708044 2:54523770-54523792 TTTGGTTAGCACGCAGGCTGTGG + Intronic
930804481 2:55476743-55476765 TGTTGAAGCCACTCAGCCTGTGG - Intergenic
931610271 2:64091282-64091304 TGTGGTAGCACAGCAGGGTGTGG + Intergenic
932290289 2:70571223-70571245 TGTGGGAGCCACCCAGTCTGAGG + Intergenic
932571192 2:72939235-72939257 TGTCGAAGCCACTCAGTCTGAGG - Intergenic
934494734 2:94787587-94787609 GGTGGTGGTCACTCAGGCTGTGG + Intergenic
935324935 2:101927460-101927482 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
936521141 2:113212829-113212851 GGTGGCAGCCAGCCAGGCTGTGG - Intergenic
936596957 2:113857252-113857274 TGTGCAAGCCACCCAGTCTGTGG + Intergenic
936651105 2:114426896-114426918 TGTTTTAGCCACACAGTCTGTGG - Intergenic
938100110 2:128492760-128492782 TGTTGAAGCCACCCAGCCTGTGG + Intergenic
938280393 2:130059961-130059983 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
938281109 2:130064291-130064313 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
938281548 2:130067035-130067057 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
938434267 2:131273050-131273072 GGTGGCAGCCACTCAGGCTGTGG - Intronic
938434589 2:131275040-131275062 GGTGGCAGCCACTCAGGCTGTGG - Intronic
938478335 2:131635857-131635879 GGTGGCAGCCACGTGGGCTGTGG - Intergenic
938907761 2:135854787-135854809 TGTGTTAGCCCAGGAGGCTGAGG + Intronic
939097745 2:137854072-137854094 TGTTTAAGCCACGCAGTCTGTGG - Intergenic
939445988 2:142310582-142310604 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
941789170 2:169532284-169532306 AGTGGTAGCTACTCCGGCTGAGG + Intronic
943651123 2:190458502-190458524 TGTTGAAGCCACCCAGTCTGTGG + Intronic
944150101 2:196548681-196548703 TGTTTAAGCCACCCAGGCTGTGG - Intronic
944614570 2:201447438-201447460 TGTTGAAGCCACCCAGTCTGTGG - Intronic
944935248 2:204561016-204561038 TGTTCTGGCCACCCAGGCTGGGG + Intronic
945191231 2:207189681-207189703 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
946528333 2:220543929-220543951 TGTTGAAGCCACTCAGTCTGTGG - Intergenic
946709588 2:222492398-222492420 TGTGGAAGCCACCAAGGCTTGGG + Intronic
946968633 2:225067481-225067503 TGTGGAAGCCACTAAGGCTTGGG - Intergenic
947095715 2:226564336-226564358 TGTGTAAGCCACCCAGTCTGTGG - Intergenic
947356675 2:229303264-229303286 TGTTTTAGCCACACAGCCTGTGG - Intergenic
948009120 2:234636658-234636680 TGTGTAAGCCACCAAGGCTGGGG - Intergenic
948307844 2:236962971-236962993 TGTGTAAGCCACCCAGTCTGCGG - Intergenic
948437222 2:237961901-237961923 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
948802270 2:240438315-240438337 TGTGGGAGCCACGTGGGCTGAGG + Intronic
1168745537 20:236609-236631 TGTTTAAGCCACACAGGCTGTGG + Intergenic
1169111766 20:3038697-3038719 TGGGGCAGCCATACAGGCTGGGG + Intronic
1171881675 20:30621973-30621995 GGAGGCAGCCACTCAGGCTGTGG + Intergenic
1171885869 20:30652243-30652265 TGTGGTGGTCACTCAGGCTGTGG + Intergenic
1173086863 20:39928663-39928685 TGAGGTAGCCAAGAAGGCTTAGG + Intergenic
1175221023 20:57416536-57416558 TGTGGGAGCCAAGCAGCCTTTGG - Intergenic
1175886092 20:62291802-62291824 TGTGGTAGCCACGCAGGCTGGGG + Intronic
1176602130 21:8803253-8803275 GGAGGCAGCCACTCAGGCTGTGG + Intergenic
1176625857 21:9091474-9091496 GGAGGCAGCCACTCAGGCTGTGG - Intergenic
1176820203 21:13649451-13649473 GGTGGCAGCCACTCAGGCTGTGG - Intergenic
1176820306 21:13650090-13650112 GGAGGCAGCCACTCAGGCTGTGG - Intergenic
1176820626 21:13652010-13652032 GGAGGCAGCCACACAGGCTGTGG - Intergenic
1178853059 21:36229211-36229233 TGTGGAAGCCACCCAGTCTGTGG - Intronic
1178927939 21:36791656-36791678 TATGGCAGACAGGCAGGCTGGGG + Intronic
1179098655 21:38337302-38337324 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
1179549288 21:42133533-42133555 TGTTCAAGCCACCCAGGCTGTGG - Intronic
1179913578 21:44462603-44462625 TGTGGCTGCCTCCCAGGCTGGGG + Intergenic
1179935903 21:44603152-44603174 TGTGGTGGCCACAGAGGCTGTGG + Intronic
1180344413 22:11694804-11694826 GGAGGCAGCCACTCAGGCTGTGG + Intergenic
1180478006 22:15729419-15729441 CGTGGCAGCCACTCGGGCTGTGG - Intergenic
1180478435 22:15732034-15732056 GGTGGCAGACACTCAGGCTGTGG - Intergenic
1180478729 22:15733826-15733848 GGTGGCAGACACTCAGGCTGTGG - Intergenic
1180479249 22:15736946-15736968 GGTGGCAGACACTCAGGCTGTGG - Intergenic
1180479439 22:15738105-15738127 GGTGGCAGCCACTCAGGCTGTGG - Intergenic
1180728834 22:17966133-17966155 TGTGGTTGTCAAGCAGGATGTGG - Intronic
1180932965 22:19605944-19605966 TGTGGTGGCCCCACAGGCAGCGG + Intergenic
1183165775 22:36146182-36146204 TGTTGGAGCCACCCAGCCTGTGG + Intronic
1183380804 22:37489610-37489632 TGTGGGAGCCTCTCAGGATGTGG - Intergenic
1183715519 22:39531117-39531139 TGTGGTGGACACCAAGGCTGCGG + Intronic
1184538948 22:45107115-45107137 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
1185280511 22:49967877-49967899 TGTGGGTGCCGGGCAGGCTGTGG + Intergenic
949215233 3:1559451-1559473 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
949571696 3:5300036-5300058 TGTTTAAGCCACGCAGTCTGTGG + Intergenic
949572113 3:5303390-5303412 TGTTTAAGCCACGCAGTCTGTGG + Intergenic
950339628 3:12231222-12231244 TGTTTTAGCCACCCAGCCTGTGG - Intergenic
950837971 3:15938731-15938753 TGTTTTAGCCACCCAGGCTATGG + Intergenic
951473811 3:23083298-23083320 TGTTGAAGCCACTCAGACTGTGG + Intergenic
951911289 3:27753386-27753408 TGAGGTAACCAGGCAGGGTGCGG + Intergenic
954224695 3:49174187-49174209 TGGGGTACCCTGGCAGGCTGAGG + Intronic
956969404 3:74504885-74504907 TTTGGAAGCCACCCAGTCTGTGG - Intronic
958685423 3:97386917-97386939 TGTGGAAGCCACCAAGGCTTGGG + Intronic
959084371 3:101835441-101835463 TGTTTAAGCCACGCAGCCTGTGG - Intronic
959284581 3:104391314-104391336 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
960424431 3:117488675-117488697 TGTTTTAGCCACTCAGTCTGTGG + Intergenic
960538451 3:118839186-118839208 TGTGGAAGCCACCAAAGCTGGGG + Intergenic
960849461 3:122036971-122036993 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
961025348 3:123550795-123550817 TGTGGGAGCCACTGAAGCTGTGG + Intronic
963746296 3:149128048-149128070 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
964483978 3:157168303-157168325 TCTGGTATACACGCAGGCTCTGG + Intergenic
965326376 3:167309547-167309569 TGTGGAAGCCACCAAGGCTTGGG + Intronic
966346908 3:178990339-178990361 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
968466983 4:757295-757317 TGTGCCAGCCACGCAGGCACAGG - Intronic
968526961 4:1064449-1064471 TGTGTAAGCCACCCAGTCTGTGG - Intronic
968859222 4:3153077-3153099 TGTTGAAGCCACCCAGGCTATGG - Intronic
968967867 4:3778420-3778442 TGTTGAAGCCGCACAGGCTGGGG - Intergenic
969163212 4:5279783-5279805 CGTGGAAGCCACCGAGGCTGGGG + Intronic
969190325 4:5513132-5513154 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
969432941 4:7166605-7166627 TGTTGAAGCCACCAAGGCTGTGG + Intergenic
969485577 4:7470748-7470770 TGTGGGCTCCATGCAGGCTGGGG - Intronic
969543980 4:7811798-7811820 TGTTTCAGCCACGCAGTCTGTGG + Intronic
969574152 4:8026700-8026722 TGTTTAAGCCACACAGGCTGTGG - Intronic
970417243 4:15871462-15871484 TGTTTTAGCCACCCAGTCTGTGG + Intergenic
970589617 4:17547881-17547903 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
971286335 4:25293525-25293547 TGTTTAAGCCATGCAGGCTGTGG - Intergenic
971366810 4:25984237-25984259 TGTGGAAGCCAGCCAGGCTGTGG - Intergenic
971593484 4:28498041-28498063 TGTGGTAGCCACCAAGACTTGGG + Intergenic
973365452 4:49205060-49205082 GGAGGCAGCCACTCAGGCTGTGG + Intergenic
973395141 4:49587394-49587416 GGAGGCAGCCACTCAGGCTGTGG - Intergenic
973601601 4:52548062-52548084 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
975417495 4:74122015-74122037 TGTGTAAGCCACCCAGTCTGTGG + Intronic
976502654 4:85809744-85809766 GGTATTAGCCATGCAGGCTGAGG + Intronic
977247175 4:94646466-94646488 TGTTGAAGCCACCCAGTCTGTGG + Intronic
977250278 4:94681598-94681620 TGTGGTGGCCTGGGAGGCTGAGG - Intergenic
977980634 4:103317327-103317349 TGTTTTAGCCACCCAGTCTGCGG - Intergenic
978591573 4:110329838-110329860 TGTGGAAGCCACCAAGGCTTAGG - Intergenic
980281223 4:130722789-130722811 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
980902456 4:138917856-138917878 TGTGAAAGCCACCCAGTCTGTGG - Intergenic
981411992 4:144442733-144442755 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
981719825 4:147790056-147790078 TGTTGGAGCCACCCAGTCTGTGG - Intronic
982445616 4:155487339-155487361 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
984049026 4:174841166-174841188 TGTTGAAGCCACCCAGTCTGTGG - Intronic
984653979 4:182297932-182297954 TGTGGGAGCAGCGCAGGCTATGG - Intronic
984707960 4:182861593-182861615 TGTGGAAGCCACCCAGTTTGCGG + Intergenic
985110287 4:186541044-186541066 GGTGGTGGGAACGCAGGCTGTGG - Intronic
985544200 5:500962-500984 TGTGGAAGCCACACGGGCTGTGG - Intronic
985861495 5:2475265-2475287 TGTTGAAGCCACCCAGGCTATGG - Intergenic
986137846 5:4999351-4999373 TGTGGAAGCCACCAAGGCTCAGG + Intergenic
986718308 5:10539834-10539856 TGTGTAAGCCACCCAGTCTGTGG - Intergenic
986772705 5:10988284-10988306 TGTGGAAGGCACACACGCTGTGG - Intronic
987575894 5:19727573-19727595 TGTGTCAGCCACCCAGCCTGTGG + Intronic
988038784 5:25861338-25861360 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
989254427 5:39351087-39351109 TGTGGAAGCCACCAAGGCTTGGG + Intronic
989434672 5:41397364-41397386 TGTGGAAGCCACCAAGGCTTGGG - Intronic
989512072 5:42299802-42299824 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
990352886 5:54936619-54936641 TGTTGAAGCCACCCAGTCTGTGG - Intergenic
990460861 5:56029703-56029725 TGTTTCAGCCACCCAGGCTGTGG + Intergenic
992954194 5:81890940-81890962 TGTGGAAGCCACGAATGCTTGGG - Intergenic
993481620 5:88431056-88431078 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
993590628 5:89790739-89790761 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
995370144 5:111409304-111409326 TGTGGAAGCCACCAAGGCTTGGG + Intronic
995418990 5:111941331-111941353 TGTGTAAGCCACTCAGTCTGTGG - Intronic
995690964 5:114825370-114825392 TGTGTTAGCCACCAAGGCTTTGG + Intergenic
995698442 5:114905803-114905825 TGTGTAAGCCACGAAGGCTTGGG + Intergenic
995837083 5:116409747-116409769 TGTGTAAGCCACTCAGTCTGTGG + Intronic
995872365 5:116756510-116756532 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
996263777 5:121508895-121508917 TGTTGCAGCCACCCAGTCTGTGG - Intergenic
997472804 5:134126103-134126125 CGTGGTGGCCAGGCAGGCAGAGG + Intronic
998512538 5:142725246-142725268 TGTTGAAGCCACTCAGCCTGTGG - Intergenic
999081566 5:148849110-148849132 TGTGTAAGCCACCCAGGCTGTGG - Intergenic
999373245 5:151068959-151068981 TGTGGAGGCCCCGCTGGCTGAGG - Intronic
1000266970 5:159647230-159647252 TGTGATGGCTACACAGGCTGGGG - Intergenic
1001507786 5:172293608-172293630 TGGAGAAGCCACCCAGGCTGTGG + Intergenic
1001874175 5:175185095-175185117 AGTGGTAAGCACGCAGGCTTTGG - Intergenic
1002012605 5:176295761-176295783 TGTGGTAGCCTCTCAGCCTCAGG + Intronic
1002215227 5:177626971-177626993 TGTGGTAGCCTCTCAGCCTCAGG - Intergenic
1002421083 5:179149389-179149411 TGTGTAAGCCACCCAGTCTGCGG + Intronic
1002910790 6:1489508-1489530 TGTTGAAGCCACCCAGGCTGCGG - Intergenic
1003009259 6:2410854-2410876 TGTCGTAACCACGAGGGCTGTGG + Intergenic
1003378750 6:5603458-5603480 TGTTGAAGCCACGCTGGCTGTGG - Intronic
1003423621 6:5980847-5980869 TATGCTGGCCACCCAGGCTGTGG + Intergenic
1003521549 6:6862696-6862718 TGTTGAAGGCACCCAGGCTGTGG - Intergenic
1003598302 6:7494674-7494696 TGTTTAAGCCCCGCAGGCTGTGG + Intergenic
1003717121 6:8659576-8659598 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
1003791520 6:9552189-9552211 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1004927721 6:20431831-20431853 TGTTGAAGCCACCCAGTCTGTGG - Intronic
1007896674 6:45369176-45369198 TGTGGTAGAAAAGGAGGCTGGGG - Intronic
1009791216 6:68403732-68403754 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1010309703 6:74370576-74370598 TGTTTTAGCCACCCAGTCTGTGG + Intergenic
1010330920 6:74623367-74623389 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1010891431 6:81316402-81316424 TGTTTTAGCCACCCAGTCTGTGG + Intergenic
1010949000 6:82012905-82012927 TGTTTAAGCCACCCAGGCTGTGG + Intergenic
1010978338 6:82341389-82341411 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1011738268 6:90334003-90334025 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1012417529 6:99026023-99026045 TGTGGTGGCAACACAGGTTGTGG - Intergenic
1012485893 6:99722385-99722407 TGTGGAAGCCACCAAGGCTTTGG - Intergenic
1014374783 6:120659278-120659300 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1014692521 6:124578727-124578749 AGTGGTAGCCAGGCAGGCCTTGG + Intronic
1015597722 6:134881556-134881578 TGTTTTAGCCACTCAGTCTGTGG - Intergenic
1016145417 6:140666160-140666182 TGTGTAAGCCACCCAGTCTGTGG + Intergenic
1016402160 6:143692860-143692882 TGTTGCAGCCACTCAGTCTGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016740979 6:147528267-147528289 TGTTGAAGCCACTCAGTCTGTGG - Intronic
1017338933 6:153297589-153297611 TGTTTAAGCCACCCAGGCTGTGG - Intergenic
1017361232 6:153574356-153574378 TGTTTAAGCCACTCAGGCTGTGG - Intergenic
1017424562 6:154306973-154306995 TGCGGAAGCCACCCAGTCTGCGG - Intronic
1017580440 6:155859197-155859219 TGTCGCAGCCACTCTGGCTGTGG + Intergenic
1017602430 6:156098236-156098258 TGTGGAAGCCACCCAGTCTGTGG + Intergenic
1018371166 6:163169806-163169828 TGTGGAAGCCACCCAGTTTGTGG - Intronic
1019324969 7:433559-433581 TGTGCTGGCAAGGCAGGCTGAGG - Intergenic
1019595172 7:1855010-1855032 TGTGGGAGGCACGTGGGCTGCGG + Intronic
1020876373 7:13699884-13699906 TGTTGAAGCCACCCAGCCTGTGG - Intergenic
1021612935 7:22475612-22475634 TGTGTTTACCATGCAGGCTGGGG - Intronic
1022809603 7:33855928-33855950 TGTTTCAGCCACCCAGGCTGTGG + Intergenic
1023348984 7:39300527-39300549 TGTGTTAGCCACCCAGTCTGCGG - Intronic
1027296714 7:76781026-76781048 TGTTCTAGCCACCCAGTCTGTGG + Intergenic
1027666472 7:81047199-81047221 TGTGGAAGCCACTAAGGCTTGGG - Intergenic
1028140962 7:87274329-87274351 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1028921262 7:96313165-96313187 TGAGACAGCCACCCAGGCTGAGG + Intronic
1028946746 7:96588648-96588670 TGTGGTAGCTCAGGAGGCTGAGG + Intronic
1029989051 7:104946407-104946429 CAGGGTACCCACGCAGGCTGGGG + Intergenic
1030620203 7:111781335-111781357 TGTGGGAGAAACTCAGGCTGAGG + Intronic
1031122963 7:117742237-117742259 TGTGGTAGCCATGGTGTCTGTGG + Intronic
1032508663 7:132454861-132454883 TGTGGGAGCCACCCAGTCTGTGG + Intronic
1032533496 7:132641238-132641260 TGTTTAAGCCACCCAGGCTGTGG - Intronic
1033151158 7:138915998-138916020 TCTGCTAGCAACCCAGGCTGTGG + Intronic
1034655182 7:152723500-152723522 TCTGGTAGAAATGCAGGCTGGGG + Intergenic
1034873149 7:154701290-154701312 GCTGATAACCACGCAGGCTGTGG + Intronic
1035690801 8:1558100-1558122 TGTGGCATCCACGCATCCTGGGG + Intronic
1035748685 8:1979833-1979855 TGTGGAAGCCACGCGGGATGAGG - Intronic
1037206003 8:16320809-16320831 TGTGTAAGCCACGAAGGCTTGGG - Intronic
1038194072 8:25350592-25350614 TGTTTAAGCCACGCAGTCTGTGG - Intronic
1038362915 8:26900909-26900931 TGCAGAAGCCACTCAGGCTGTGG - Intergenic
1038487383 8:27946560-27946582 TGTTTAAGCCATGCAGGCTGCGG + Intronic
1038689530 8:29748601-29748623 TGTTGAAGCCACCCAGTCTGTGG + Intergenic
1038759780 8:30375719-30375741 TGTTTTAGCCACCCAGTCTGTGG - Intergenic
1039100286 8:33934378-33934400 TGTTGAAGCCACTCAGACTGTGG - Intergenic
1040101929 8:43513290-43513312 TGTAGTGGCCACTCAGGCTGTGG - Intergenic
1040624161 8:49126454-49126476 TGTTTAAGCCACACAGGCTGTGG - Intergenic
1041655832 8:60349787-60349809 TGTTTTAGCCACCCAGCCTGTGG - Intergenic
1041709152 8:60877014-60877036 TGTTTCAGCCACGCAGTCTGTGG + Intergenic
1041719144 8:60960670-60960692 TGTGGGAGCCACAGAGGCAGAGG - Intergenic
1042020824 8:64370310-64370332 CGTGGGCGCCACGCAGGCCGCGG + Intergenic
1042501648 8:69515299-69515321 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1043204944 8:77426299-77426321 TGTGGAAGCCACCAAGGCTTAGG - Intergenic
1045388825 8:101694972-101694994 TGTGGGAGCAAAGCAAGCTGGGG - Intronic
1045651317 8:104343917-104343939 TGTTGAAGCCACCCAGCCTGTGG + Intronic
1045664117 8:104467202-104467224 TGAGGTATCCACCCAGGCTTCGG + Intergenic
1046627997 8:116595657-116595679 TGTTGAAGCCACCCAGCCTGTGG + Intergenic
1047648833 8:126898348-126898370 TGAGGAAGCCAAGAAGGCTGAGG + Intergenic
1047783495 8:128130881-128130903 TGTGTAAGACACGCAGGGTGGGG + Intergenic
1049765270 8:144352513-144352535 TGTGGAAGCCGAGAAGGCTGTGG - Intronic
1050038758 9:1465230-1465252 TGTTTAAGCCACCCAGGCTGTGG + Intergenic
1050158253 9:2690707-2690729 TGTGTAAGCCACTCAGTCTGTGG - Intergenic
1052122770 9:24738593-24738615 TGTGGGACCCACGGAGCCTGCGG - Intergenic
1052877198 9:33575861-33575883 AGTGGCAGCCCCTCAGGCTGTGG - Intergenic
1053498803 9:38568533-38568555 AGTGGCAGCCCCTCAGGCTGTGG + Intronic
1053510766 9:38686334-38686356 TGTGGCGGGCAGGCAGGCTGGGG - Intergenic
1053917067 9:42951395-42951417 AGTGGCAGCCAGGCAGGCTTGGG - Intergenic
1055698641 9:78917226-78917248 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1055701541 9:78950001-78950023 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1056765068 9:89440131-89440153 CCTGGGAGCCACGCAGGCTGTGG + Intronic
1056957806 9:91096438-91096460 TGTTGAAGCCACACAGTCTGTGG - Intergenic
1057017235 9:91663251-91663273 TGTGGGGGACACACAGGCTGGGG + Intronic
1057161857 9:92894831-92894853 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1057169267 9:92951029-92951051 GGTGGGAGCCCTGCAGGCTGAGG + Intronic
1057559199 9:96114071-96114093 TGCGGCAGCCACCCAGGCTGTGG - Intronic
1057606331 9:96499967-96499989 TGTGTCAGCCACCCAGTCTGGGG + Intronic
1057678257 9:97153026-97153048 GGTGGCAGCCCCTCAGGCTGTGG + Intergenic
1058174661 9:101723053-101723075 TGTGGGAGGCACGCAGGGGGAGG + Intronic
1059718892 9:116939493-116939515 TTTGGTAGACACGAAGGATGGGG - Intronic
1060421548 9:123472871-123472893 TGGGGAGGCCACTCAGGCTGGGG + Intronic
1060512227 9:124242485-124242507 TGTGGTGCCCAAGCAGGCTTTGG + Intergenic
1061956040 9:133961828-133961850 TCTGGTGGCCACGCAGGCCTAGG + Intronic
1062232482 9:135489580-135489602 TGTAGTAGCCACGGACACTGCGG - Intergenic
1062506395 9:136879649-136879671 TTTGCTCGCCACCCAGGCTGGGG + Intronic
1062530478 9:136997355-136997377 TCTTCCAGCCACGCAGGCTGTGG - Intergenic
1062677109 9:137753084-137753106 TGTGGAACCCTCACAGGCTGGGG - Intronic
1203527055 Un_GL000213v1:99461-99483 GGAGGCAGCCACTCAGGCTGTGG + Intergenic
1203527157 Un_GL000213v1:100100-100122 GGTGGCAGCCACTCAGGCTGTGG + Intergenic
1203749030 Un_GL000218v1:61895-61917 GGAGGCAGCCACTCAGGCTGTGG - Intergenic
1185924701 X:4133269-4133291 TGTTTAAGCCACCCAGGCTGTGG - Intergenic
1186372884 X:8965390-8965412 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1186513696 X:10150178-10150200 TGTCGAAGCCACCCAGTCTGTGG - Intergenic
1188325537 X:28797013-28797035 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1188379435 X:29473005-29473027 TGTTGAAGCCACCCAGTCTGTGG - Intronic
1188925950 X:36044010-36044032 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1188982914 X:36743218-36743240 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1189035123 X:37487796-37487818 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1189469784 X:41304723-41304745 GGTGGAAGCCACCCAGACTGTGG + Intergenic
1190583007 X:51906756-51906778 TGTTTTAGCCACTCAGTCTGTGG + Intergenic
1190598887 X:52069668-52069690 TTTCGTAGCCCCGCAGGTTGAGG - Intergenic
1190609937 X:52184405-52184427 TTTCGTAGCCCCGCAGGTTGAGG + Intergenic
1190950605 X:55139652-55139674 TGTGGAAGCCACCAAGGCTTGGG - Intronic
1193066378 X:77264823-77264845 TGTGGAAGCCACCAAGGCTTCGG - Intergenic
1193840702 X:86404931-86404953 TGTGGAAGCCACCAAGGCTTGGG + Intronic
1193857856 X:86626701-86626723 TGTGGAAGCCACAAAGGCTTGGG + Intronic
1194435056 X:93859928-93859950 TGTGGAAGCCACCCAGGCTTGGG - Intergenic
1194548900 X:95272539-95272561 TGTGGAAGCCACCAAGGCTTGGG + Intergenic
1194944182 X:100048577-100048599 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1195206927 X:102610768-102610790 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1195511094 X:105716038-105716060 TGTGGTAGTCCCACATGCTGAGG - Intronic
1196233718 X:113255240-113255262 GGTAGTAGCCAGGCAGGCAGTGG - Intergenic
1198566057 X:137906705-137906727 TGTGTTAGCCACCAAGGCTTGGG - Intergenic
1199000684 X:142632772-142632794 AGTGGTGGCCACTCAGGGTGAGG + Intergenic
1199009660 X:142744049-142744071 TGTTGAAGACACCCAGGCTGTGG - Intergenic
1199139221 X:144290058-144290080 TGTGGAAGCCACCAAGGCTTGGG - Intergenic
1199871017 X:151899032-151899054 TGTGCAAACCACGCATGCTGTGG - Intergenic
1200233983 X:154459482-154459504 AGGGGGAGCCATGCAGGCTGTGG + Intronic