ID: 1175888557

View in Genome Browser
Species Human (GRCh38)
Location 20:62305914-62305936
Sequence TGGGGAGCCTAGAGCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888557_1175888566 -2 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888566 20:62305935-62305957 CATTTGTGAAATGGGCGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 219
1175888557_1175888573 25 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888573 20:62305962-62305984 GGGCACACCCGGGATTGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1175888557_1175888574 29 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888557_1175888560 -7 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888560 20:62305930-62305952 CTCCCCATTTGTGAAATGGGCGG 0: 1
1: 0
2: 15
3: 86
4: 436
1175888557_1175888575 30 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888575 20:62305967-62305989 CACCCGGGATTGCGGCGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1175888557_1175888563 -4 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888563 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 23
4: 162
1175888557_1175888568 4 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888568 20:62305941-62305963 TGAAATGGGCGGAGGGGGACAGG 0: 1
1: 0
2: 1
3: 20
4: 272
1175888557_1175888572 22 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888572 20:62305959-62305981 ACAGGGCACACCCGGGATTGCGG 0: 1
1: 0
2: 0
3: 12
4: 92
1175888557_1175888567 -1 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888567 20:62305936-62305958 ATTTGTGAAATGGGCGGAGGGGG No data
1175888557_1175888570 14 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888570 20:62305951-62305973 GGAGGGGGACAGGGCACACCCGG 0: 1
1: 0
2: 5
3: 145
4: 3700
1175888557_1175888571 15 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888571 20:62305952-62305974 GAGGGGGACAGGGCACACCCGGG 0: 1
1: 0
2: 7
3: 49
4: 610
1175888557_1175888569 5 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888569 20:62305942-62305964 GAAATGGGCGGAGGGGGACAGGG 0: 1
1: 0
2: 2
3: 40
4: 460
1175888557_1175888559 -10 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888559 20:62305927-62305949 AGGCTCCCCATTTGTGAAATGGG 0: 1
1: 0
2: 19
3: 224
4: 1440
1175888557_1175888565 -3 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888565 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 4
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888557 Original CRISPR TGGGGAGCCTAGAGCTCCGA AGG (reversed) Intronic
900144581 1:1152471-1152493 TGGAGAGCCTGGATCCCCGATGG - Intergenic
900144674 1:1152901-1152923 TGGAGAGCCTGGATCCCCGATGG - Intergenic
900144745 1:1153245-1153267 TGGAGAGCCTGGATCCCCGATGG - Intergenic
900641981 1:3691879-3691901 TGGGGAGCCCACGGCTCCAAAGG - Intronic
903667010 1:25014202-25014224 TGGGGAGCCTAGAGTCCCTTTGG - Intergenic
906827593 1:48998361-48998383 TGGGCAGGCTATAGCTCAGAGGG - Intronic
907223074 1:52921418-52921440 TGGGGCGCCTAGAACTGGGAGGG + Intronic
911181464 1:94864222-94864244 TGGGGAGCCTAGAGCTGTGTAGG + Intronic
915827155 1:159090096-159090118 TGGGAACCCTAGAGCTGGGATGG - Intronic
918002285 1:180508901-180508923 TGGGGAGGCTAGGGCTGCGCAGG - Intergenic
920575518 1:207057029-207057051 TAGGGAGCCAAAACCTCCGAAGG + Intronic
920610324 1:207429780-207429802 TTGGGAGACTAGATCTCCGACGG + Intergenic
920855626 1:209658963-209658985 TGGGGAGTTTACAGCTCCTAAGG - Intergenic
922959099 1:229630378-229630400 TGGGTGACCAAGAGCTCCGATGG - Intronic
923557064 1:235009689-235009711 TGGGGATTCTAGAGCTGCCAAGG + Intergenic
1065530120 10:26661111-26661133 TGAGGTGCCTACAGCTCCTAGGG - Intergenic
1068344790 10:55761601-55761623 TGGGAAGCCTAGAGCTCACCTGG + Intergenic
1076480836 10:130784368-130784390 TGGGAAGCCTCGAGTTCCAAAGG + Intergenic
1076628981 10:131841515-131841537 TGGCCAGCCTTGAGCTCCGTGGG + Intergenic
1077316730 11:1922646-1922668 TGGGGCGCCAAGAGCTGGGAGGG + Intronic
1077442148 11:2573875-2573897 TGGGGAGCCTGCAGCTCGGAGGG - Intronic
1083256043 11:61496072-61496094 TGTGGAGCCTAGAGGGCTGACGG + Intergenic
1083295884 11:61715473-61715495 TGGGGCTCCAAGAGCTCCCAGGG - Intronic
1083905019 11:65663488-65663510 TGCGGAGCCTACAGCCCGGATGG + Intergenic
1084761673 11:71276550-71276572 TGGTCATCCAAGAGCTCCGATGG + Intergenic
1085340126 11:75725894-75725916 TGGGGACCCTTGGACTCCGATGG + Intronic
1087337970 11:96867716-96867738 TGGGGAGCCTAGGAGTCCAAAGG + Intergenic
1088838207 11:113597280-113597302 TGGGGAGAAGAGAGCTCCCAGGG - Intergenic
1090656540 11:128850156-128850178 GGGGGAGAGTAGAGCTCCAAGGG - Intronic
1091847547 12:3669092-3669114 TGGGGTGCTTTGAGCTCTGAAGG - Intronic
1095811094 12:46373456-46373478 TGGGGAGCCCGGCGCTCCTAAGG + Intergenic
1096263695 12:50107943-50107965 TGGAGAGACTGGAGCTCAGATGG - Intronic
1096542019 12:52313313-52313335 TGGGGAGCCTGGAGATTCCAGGG + Intergenic
1104062338 12:125279151-125279173 TGAGGACCCTGGAGCTCAGAAGG - Intronic
1109211223 13:59538104-59538126 AGGGGAGCCCACAGCTCTGAAGG - Intergenic
1112506603 13:99979979-99980001 TGGGGAGCTCAGCGCGCCGAGGG + Intergenic
1118969692 14:70623628-70623650 TGGGGAGAGTAGAGCTGCAAAGG + Intergenic
1121600583 14:95200175-95200197 TGGGGAGCCTAGAACTGGGGAGG - Intronic
1125452181 15:39820435-39820457 CTGGGAGCCTAGAGCTCTGTAGG + Intronic
1126435451 15:48632866-48632888 TGGGGAGCACAGAGCTCACAGGG + Intronic
1127553884 15:60068152-60068174 TGGGGAGCTTAGAGCAAAGATGG + Intergenic
1131909811 15:97185998-97186020 TGGTCACCCAAGAGCTCCGAAGG - Intergenic
1132677145 16:1125520-1125542 GTGGGAGCCTGGAGCTCCCAGGG + Intergenic
1136032171 16:27511294-27511316 TGGAGAGCCTGGAGTTCTGATGG - Intronic
1137780288 16:51092464-51092486 TGGGGAGCGTTGAGATCGGATGG + Intergenic
1141685506 16:85567559-85567581 TGGCGGCCCCAGAGCTCCGAAGG + Intergenic
1144165540 17:12606703-12606725 TGGTCACCCAAGAGCTCCGATGG - Intergenic
1145935574 17:28712771-28712793 TGAGGAGCCCAGTGCTGCGAGGG + Intergenic
1148123822 17:45226829-45226851 TGGGGACCCTTGAACTCTGATGG + Intronic
1151582959 17:74990575-74990597 TGGGGAGCCTCCAGCTCAAAAGG - Intronic
1153201744 18:2655108-2655130 TGGGGGCCCTGGAGCGCCGACGG - Intergenic
1153978660 18:10291048-10291070 TGGGAAGCCATGAGCTCAGAGGG + Intergenic
1156209209 18:34920476-34920498 TGTGAAGCCAAGTGCTCCGAAGG - Intergenic
1157288161 18:46391529-46391551 TGGGAAGCCTGGAGCTCCTGAGG + Intronic
1161627164 19:5334040-5334062 TGGAGTGCCTGGAGCTCCCAAGG + Intronic
1162184878 19:8897139-8897161 TGGTGAGCCCAGAGCTCCGATGG + Exonic
1162185312 19:8900301-8900323 TGGGGGCCACAGAGCTCCGATGG + Exonic
1162187431 19:8916870-8916892 TGGTGGGCATAGAGCTTCGATGG + Exonic
1166678558 19:44754142-44754164 TTGGGATCCTGGAGCTCTGAAGG + Intronic
931572288 2:63681300-63681322 AGGGGAGCCCACTGCTCCGAAGG + Intronic
935288886 2:101592337-101592359 TGGTCACCCAAGAGCTCCGATGG - Intergenic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
944933848 2:204546289-204546311 TTGTGGGCCTTGAGCTCCGAGGG + Intronic
948845638 2:240681648-240681670 GGTGGAGCCTAGCGCTCGGAGGG + Intronic
948848217 2:240693082-240693104 GGTGGAGCCTAGCGCTCGGAGGG - Intronic
1169616336 20:7450374-7450396 TGGGCACCCAAGAGCTCTGATGG + Intergenic
1170885301 20:20335669-20335691 TGGGGAGTCTAGGGCTGCCAGGG - Intronic
1175831963 20:61969782-61969804 TGGGGGGCCGAGTGCTCCGATGG - Intronic
1175831980 20:61969823-61969845 TGGGGGGCCGAGTGCCCCGATGG - Intronic
1175831987 20:61969843-61969865 TGGGGGGCCGAGTGTTCCGATGG - Intronic
1175888557 20:62305914-62305936 TGGGGAGCCTAGAGCTCCGAAGG - Intronic
1175952111 20:62589044-62589066 TGGGGAGCTGAGAGCTCTGCCGG - Intergenic
1179727547 21:43348778-43348800 TGAGGGGCCATGAGCTCCGAGGG - Intergenic
1179827366 21:43973731-43973753 TGGGGAGCCTGGCGCTGTGATGG - Intronic
1180885242 22:19238781-19238803 GAGGGAGCCTAGAGCTCCCAGGG - Intronic
1181308532 22:21930929-21930951 TATGGAGCCCAGAGCTCCGGGGG - Intronic
1181968368 22:26672232-26672254 GGGGGAGCCCAGAGCTCGGCAGG - Intergenic
1184004081 22:41696330-41696352 TGGAGAGCCTCGAGCACCAAGGG + Exonic
954415104 3:50389544-50389566 AGGGGAGCCTAGGGCTCCTGAGG - Intronic
954468607 3:50673638-50673660 GGAGGAGCCTAAAGGTCCGAAGG + Intergenic
959592492 3:108095490-108095512 TGGAGAACCTAGAGTTCTGATGG + Intergenic
960814259 3:121657303-121657325 TGGGGAGCCAAGACCATCGAGGG - Exonic
962116052 3:132508946-132508968 TGGTCACCCAAGAGCTCCGATGG + Intronic
964035366 3:152189343-152189365 TGGTGATCCAAGAGCTCTGATGG + Intergenic
964636186 3:158860378-158860400 TGGGGAGCCTGGAGATGCCAAGG - Intergenic
966024048 3:175253461-175253483 TGGTCACCCAAGAGCTCCGATGG + Intronic
966637915 3:182156556-182156578 TGGGGATGCTAGAGCTTCGTTGG - Intergenic
967297736 3:187981754-187981776 TGGGGACCCTGGAGCTCTGGGGG + Intergenic
971044923 4:22794985-22795007 TGTGGAGTTTAGGGCTCCGAAGG + Intergenic
975249154 4:72157236-72157258 GGCGGAGCCAAGAGCTCAGAGGG + Intergenic
978382439 4:108143827-108143849 TGTGGAGCCCACAGCTCCGGGGG - Intronic
985843903 5:2330019-2330041 GGGAGAGCCCAGCGCTCCGAGGG + Intergenic
987088978 5:14494479-14494501 TGGTCACCCAAGAGCTCCGATGG + Intronic
991472759 5:66986240-66986262 TGGGGAGCACAGAGCTGGGAAGG + Intronic
998137683 5:139682715-139682737 TGGGGTGGCAGGAGCTCCGAGGG + Intronic
999144401 5:149382825-149382847 AGGGGATCCGAGAGCTCCCAGGG + Intronic
1002011796 5:176289160-176289182 TGGGGAAACTAGAGTTCAGAGGG - Intronic
1005146872 6:22701589-22701611 TGAGGAGCCTAGAGGTTGGAAGG + Intergenic
1008036166 6:46747467-46747489 TAGGCAGCCTAGGGCTGCGATGG - Intronic
1008771799 6:54988044-54988066 TGGGGAGCATAGAGATGTGAGGG + Intergenic
1008904247 6:56658782-56658804 TGGAGAGCTCAGAGCTCCAAAGG + Intronic
1019180096 6:170181292-170181314 TGGTGAGCCTAGGGCACCGCTGG - Intergenic
1019482140 7:1271869-1271891 TGGGGAGCCGTGGGCTCTGAGGG - Intergenic
1026256053 7:68712404-68712426 TGGTCACCCAAGAGCTCCGATGG - Intergenic
1029227160 7:99036527-99036549 TTGGGAGCCAAGAGCTTGGATGG - Intronic
1029453650 7:100656251-100656273 CGGGGTGCCCAGAGCTCGGATGG + Intronic
1031183616 7:118447746-118447768 TGGTGACCCAAGAGCTCTGATGG - Intergenic
1038318487 8:26508012-26508034 TTGGGAGCCTAGAGAGCCGCAGG - Exonic
1048977954 8:139683561-139683583 TGGGGAGACTAAAGCCCAGACGG + Intronic
1049202302 8:141346290-141346312 GGGGGAGCCAAGAGCCCCCACGG - Intergenic
1052371262 9:27667414-27667436 TGGTCAGCCAAGAGCTCTGATGG - Intergenic
1053011720 9:34637483-34637505 AGCGGAGCCTAGGGTTCCGAAGG - Intronic
1055633975 9:78256179-78256201 GGGGAAGCCTACAGCTCAGAGGG + Intronic
1062282635 9:135758869-135758891 GGGGGTGCCCAGAGCTGCGAGGG + Intronic
1062434027 9:136538485-136538507 TGTGGGGCCCGGAGCTCCGAGGG - Intronic
1062625962 9:137441612-137441634 GGAGGAGCCTGGAGCTGCGAGGG + Intronic
1195199386 X:102533045-102533067 AGGGGAGCCCAGTGCTCTGAAGG + Intergenic
1197521320 X:127500997-127501019 TGGAGAGCCAAGAGAGCCGATGG + Intergenic
1198492147 X:137152471-137152493 TGGGGAGCCCAGATATCCCAAGG - Intergenic
1200002143 X:153067555-153067577 TGGGAAGCCTGGAGCAGCGAGGG - Intergenic
1200005590 X:153082470-153082492 TGGGAAGCCTGGAGCAGCGAGGG + Intergenic