ID: 1175888561

View in Genome Browser
Species Human (GRCh38)
Location 20:62305932-62305954
Sequence CTCCGCCCATTTCACAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 6, 3: 84, 4: 633}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888561_1175888580 19 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888580 20:62305974-62305996 GATTGCGGCGGATGGGGACAGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1175888561_1175888574 11 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888561_1175888570 -4 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888570 20:62305951-62305973 GGAGGGGGACAGGGCACACCCGG 0: 1
1: 0
2: 5
3: 145
4: 3700
1175888561_1175888575 12 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888575 20:62305967-62305989 CACCCGGGATTGCGGCGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1175888561_1175888571 -3 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888571 20:62305952-62305974 GAGGGGGACAGGGCACACCCGGG 0: 1
1: 0
2: 7
3: 49
4: 610
1175888561_1175888572 4 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888572 20:62305959-62305981 ACAGGGCACACCCGGGATTGCGG 0: 1
1: 0
2: 0
3: 12
4: 92
1175888561_1175888573 7 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888573 20:62305962-62305984 GGGCACACCCGGGATTGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1175888561_1175888579 18 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888579 20:62305973-62305995 GGATTGCGGCGGATGGGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1175888561_1175888576 13 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888576 20:62305968-62305990 ACCCGGGATTGCGGCGGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888561 Original CRISPR CTCCGCCCATTTCACAAATG GGG (reversed) Intronic
900343074 1:2197744-2197766 CTCCTCCCATGTCACCACTGGGG + Intronic
900937163 1:5773705-5773727 GGCCTCCCATTTCACAGATGTGG + Intergenic
901861690 1:12078755-12078777 GTCAGCCCATTTTACAGATGGGG - Intronic
901937271 1:12635534-12635556 CTGTCCCCATTTCACAGATGTGG - Intergenic
902077003 1:13795324-13795346 GTTCTCCCATTTTACAAATGGGG + Intronic
902133429 1:14283405-14283427 CTCCACCCAATTAAAAAATGGGG + Intergenic
902186409 1:14728813-14728835 CTACCCCCATTTTACAGATGAGG - Intronic
902203074 1:14848381-14848403 CTGCACCCATTTTACAGATGAGG - Intronic
902265588 1:15261214-15261236 CTTCCCCCATTTTACAGATGAGG + Intronic
902624867 1:17670756-17670778 CTGGGCCCATTTTACAGATGGGG + Intronic
902744708 1:18465911-18465933 CCCCACCCATTTTACAGATGGGG + Intergenic
902808703 1:18876213-18876235 ATTCTCCCATTTCACAGATGAGG - Intronic
903021486 1:20398432-20398454 GTTAACCCATTTCACAAATGAGG + Intergenic
903305450 1:22409709-22409731 CTTGGCCCATTTTACAGATGAGG - Intergenic
903367276 1:22812680-22812702 CTATGCCCATTTTACAGATGAGG - Intronic
903445840 1:23422772-23422794 CTCTTCCCATTTCACAGAAGAGG + Intronic
903577691 1:24349057-24349079 CTATGCCCATTTTACAAGTGAGG + Intronic
903769069 1:25752818-25752840 CTGTTCCCATTTCACAAATGGGG - Intronic
903831863 1:26180304-26180326 TTCTGCCCATTTCACAGATGAGG - Intronic
904012348 1:27397077-27397099 CTCCGACCACTTCCCAAATGTGG - Intergenic
904035195 1:27555296-27555318 CCCCTCCCATTTTACAGATGAGG + Intronic
904130647 1:28272942-28272964 ATCTCCCCATTTCACAGATGAGG - Intronic
904238236 1:29127653-29127675 CTATGCCCAGTTCACATATGTGG + Intergenic
904340973 1:29834316-29834338 CTGTGCCCATTTCACAGAGGGGG - Intergenic
904404672 1:30278353-30278375 CTGTCCCCATTTCACAGATGAGG + Intergenic
904465264 1:30703934-30703956 CTCACCCCATATCACAGATGAGG + Intergenic
904817829 1:33219214-33219236 CTGGACCCATTTCACAGATGGGG - Intergenic
904871087 1:33618758-33618780 CACATCCCATTTCACAGATGAGG + Intronic
904933744 1:34111620-34111642 TTCATCCCATTTAACAAATGGGG + Intronic
904946826 1:34205503-34205525 ATGAACCCATTTCACAAATGAGG - Intronic
905494822 1:38376630-38376652 CTTAGCCCATATCACAAATGAGG - Intergenic
905719372 1:40183783-40183805 ATCAGCCCATTTCAAAAATGAGG - Intronic
905737389 1:40339144-40339166 TTCTCCCCATCTCACAAATGAGG - Intergenic
905861630 1:41355810-41355832 CTCCACCCATTTGACTGATGAGG + Intergenic
905944529 1:41890590-41890612 CTTGGACCATTTTACAAATGAGG + Intronic
905951447 1:41954796-41954818 TTACCCCTATTTCACAAATGAGG - Intronic
906070290 1:43011379-43011401 CTTTTCCCATCTCACAAATGAGG - Intergenic
906686183 1:47764855-47764877 CTATCCCCATTTCACAGATGAGG - Exonic
906700606 1:47854969-47854991 TTACCCTCATTTCACAAATGAGG - Intronic
907013119 1:50983607-50983629 TTACCCCCATTTCACAGATGTGG - Intergenic
907274970 1:53311857-53311879 CTCCACCCATTGTACAGATGGGG - Intronic
907307393 1:53520898-53520920 GTCAGCCCATTTCACAGATGGGG - Intronic
907323367 1:53619529-53619551 ATCAGCCCATTTTACAGATGAGG + Intronic
907332989 1:53683487-53683509 TTCTCCCCATTTCACAGATGAGG - Intronic
907399415 1:54215694-54215716 CTCACCCCATTTGACAGATGAGG - Intronic
907460637 1:54603547-54603569 CTGATCCCATTTCACAGATGAGG + Intronic
907499383 1:54867193-54867215 CTACCCCCATTTCACAGAGGAGG - Intronic
907834601 1:58097203-58097225 TTACCCCCACTTCACAAATGTGG + Intronic
907936592 1:59047244-59047266 CTTTCCCCATTTCACAGATGAGG - Intergenic
908028111 1:59972167-59972189 CTCCTCTTATTTCACAAATGAGG + Intergenic
908403535 1:63792368-63792390 CTTCCCCCATGTCACAGATGAGG + Intronic
908436906 1:64115828-64115850 CTCCTCCCATTTAATAGATGAGG - Intronic
908516807 1:64900972-64900994 CTTCTCCCATTTCCCAAGTGAGG + Intronic
908679031 1:66638745-66638767 CTCCACCCATTTGTCAAATTGGG + Intronic
910749386 1:90612178-90612200 CCTAGCCCATTTCACAGATGAGG + Intergenic
912239913 1:107895473-107895495 CTACCCCCATTTTACAGATGAGG + Intronic
913690248 1:121272824-121272846 TTCCTCCCATTTCACAAAGAGGG - Intronic
915674377 1:157516881-157516903 CTACTCCCATTTTACAGATGAGG - Intronic
915725034 1:158011387-158011409 TTCAGCCCATTTTACAGATGAGG - Intronic
916786394 1:168090111-168090133 GTACCCCCATTTCACAGATGGGG + Intronic
917188107 1:172384458-172384480 CTACCCTCATTTCACAGATGAGG + Intronic
917483060 1:175429446-175429468 TTTTGCCCATTTCACAGATGAGG - Intronic
917642692 1:176998209-176998231 CTCCTCACATTTTACAGATGAGG - Intronic
917687603 1:177433284-177433306 CTAGGCCCATTTTACAAATGTGG + Intergenic
917922775 1:179764828-179764850 CTACCCCCTTTTTACAAATGAGG - Intronic
918197487 1:182235774-182235796 AAGTGCCCATTTCACAAATGAGG + Intergenic
918501656 1:185202383-185202405 TTACCCCCATTTCACAGATGGGG - Intronic
919827096 1:201510949-201510971 AACCTCCCATTTCACACATGAGG - Intergenic
921132930 1:212235233-212235255 TTATGCCTATTTCACAAATGAGG - Intergenic
921179742 1:212622676-212622698 CTACCCCCATTTTACAGATGAGG + Intergenic
922029114 1:221781097-221781119 CTGTGTCCATTTCACAGATGAGG + Intergenic
923189428 1:231606330-231606352 TTACCCCCATTTCACAAATGGGG - Intronic
923436848 1:233975513-233975535 CTTTCCCCATTTGACAAATGAGG + Intronic
924312166 1:242755312-242755334 CTGTTCTCATTTCACAAATGAGG + Intergenic
924382772 1:243479646-243479668 CTCCTCTCATTTCACATGTGAGG + Intronic
924464143 1:244284970-244284992 CTCACCCCATTTCACAGATGGGG + Intergenic
1064219237 10:13425564-13425586 TTGCTCCCATTTCACAGATGAGG + Intergenic
1066351569 10:34641732-34641754 ATCAGCCCATTTCACGAATGGGG - Intronic
1067061538 10:43080436-43080458 CTTGGCCCATTTCACAGGTGAGG + Intronic
1067448660 10:46368167-46368189 CTATGCCCATTTTACAGATGAGG + Intergenic
1067588711 10:47492598-47492620 CTATGCCCATTTTACAGATGAGG - Intergenic
1067635839 10:48000689-48000711 CTATGCCCATTTTACAGATGAGG - Intergenic
1067877661 10:50019633-50019655 CTATGCCCATTTTACAGATGAGG + Intergenic
1067961944 10:50864204-50864226 ATCACCCCAATTCACAAATGAGG - Intronic
1069782436 10:70965275-70965297 CTCTCCCCATTTGACAAATGAGG - Intergenic
1070650603 10:78232884-78232906 ATCAGACCATTTCACAGATGAGG - Intergenic
1070684427 10:78470450-78470472 CCCCACCCATTTCACAGATGAGG + Intergenic
1070771605 10:79085556-79085578 CTCTGCCCATTTTTCAGATGAGG - Intronic
1070977498 10:80616975-80616997 TTAGCCCCATTTCACAAATGAGG + Intronic
1071053428 10:81479445-81479467 CAACACCCATTTAACAAATGTGG + Intergenic
1072619000 10:97067636-97067658 TTGCGCCCATTTCACAGAGGAGG + Intronic
1072784237 10:98269136-98269158 CTCTGCCCATTTTACAGATGGGG - Intergenic
1073425995 10:103455890-103455912 CTATGCCCATTTTACAGATGAGG - Intronic
1073479407 10:103777098-103777120 CTGTTCCCATTTCACAGATGAGG - Intronic
1074101150 10:110355786-110355808 GTCCACTCATTTCACAGATGAGG - Intergenic
1074137669 10:110642623-110642645 TTTTTCCCATTTCACAAATGTGG - Intergenic
1074557086 10:114501199-114501221 ATATGCCCATTTCACAGATGAGG + Intronic
1075563752 10:123488099-123488121 TTCTGCCCATTTCAGAGATGTGG - Intergenic
1075732966 10:124647232-124647254 CTAGACCCATTTCATAAATGGGG + Intronic
1076229967 10:128812011-128812033 CTCCTCTCAGTTCAGAAATGGGG - Intergenic
1078527015 11:12109220-12109242 ATCATCCCATTTCACAGATGTGG - Intronic
1078537779 11:12188749-12188771 TTGCGTCCATTTCACAGATGAGG - Intronic
1078667823 11:13340919-13340941 ATCCACCCCTTTCACAGATGAGG + Intronic
1079017324 11:16880190-16880212 CACCCCCCATTTTACAGATGAGG - Intronic
1079474569 11:20815484-20815506 CTTTGCCCATTTCTTAAATGGGG + Intronic
1081121022 11:39266447-39266469 TTCAACCCATTTCACAAGTGAGG + Intergenic
1081536546 11:44000912-44000934 ATAAGCCCATTTCACAGATGAGG + Intergenic
1081671092 11:44943116-44943138 CTACCCCCATTTCACAAGAGGGG - Intronic
1081675836 11:44968610-44968632 CGAAGCCCATTTCACAAGTGAGG + Intergenic
1081744385 11:45462799-45462821 CACCCCTCATTTCACAGATGGGG + Intergenic
1081830586 11:46109235-46109257 CTACCTCCATTTTACAAATGAGG - Intronic
1083045129 11:59727624-59727646 CTCTATCCATTTTACAAATGTGG - Intronic
1083115907 11:60459534-60459556 TTCTGTTCATTTCACAAATGAGG - Intronic
1083190888 11:61051521-61051543 TTCTCCCCATTTCACAGATGAGG - Intergenic
1083222176 11:61259554-61259576 CTGTGCCCATTTTACAGATGAGG - Intronic
1083291655 11:61693893-61693915 CTCCTCCCATTTTACATAAGAGG + Intronic
1083490408 11:63011254-63011276 CTTATCCCATTTCACAGATGAGG - Intronic
1083622171 11:64054621-64054643 CTCCACCCATTTTAAAGATGAGG - Intronic
1084581218 11:70024617-70024639 CTCTCCCCAGTTCACAGATGGGG + Intergenic
1084680442 11:70663410-70663432 ATCCTCCCATTTTACAGATGAGG + Intronic
1085252737 11:75154255-75154277 CTGGGCCCATTTTCCAAATGAGG + Intronic
1085391812 11:76185966-76185988 CCACTCCCATTTTACAAATGGGG + Intergenic
1085445758 11:76599564-76599586 TTACGCCCATTTCATAAGTGAGG - Intergenic
1085709975 11:78820461-78820483 TTCACCCCATTTCACAAATGAGG - Intronic
1085723723 11:78935458-78935480 CTCTGCCCATTTTACAGGTGAGG + Intronic
1085776661 11:79372674-79372696 CCCCTCCCATTTCACAGAAGAGG - Intronic
1085936357 11:81150598-81150620 TTACACCCATTTCACATATGAGG - Intergenic
1086379953 11:86242265-86242287 CTACCCACATTTTACAAATGAGG - Intergenic
1086478092 11:87201657-87201679 CTCCTCACATTTCACAAAGCAGG - Intronic
1086961155 11:92981216-92981238 CTGCCCCTAGTTCACAAATGAGG + Intronic
1087261452 11:96017157-96017179 TTCCTCCCATTTCATAGATGAGG + Intronic
1087853712 11:103064874-103064896 CTATCCCCATTTAACAAATGAGG - Intronic
1088496222 11:110433841-110433863 GTGATCCCATTTCACAAATGAGG - Intronic
1088556159 11:111063459-111063481 CTCTTCTCATTTCACAGATGAGG + Intergenic
1088691634 11:112333381-112333403 CTCCCCACCTTTAACAAATGAGG - Intergenic
1089312823 11:117571335-117571357 CTGTGCCCATTTCACAGAGGAGG + Intronic
1089351893 11:117826010-117826032 CTGCGCCCATTTTACAGATGAGG - Intronic
1089365913 11:117920919-117920941 GTCTGCCCATTTTACACATGTGG - Intronic
1089396154 11:118137287-118137309 CTACCTCTATTTCACAAATGAGG - Intronic
1089627246 11:119759204-119759226 TTACGTCCATTTTACAAATGAGG - Intergenic
1089667801 11:120031424-120031446 CTCCCCCCATCTTACAGATGAGG - Intergenic
1089795068 11:120973665-120973687 CTCCAGCCATGGCACAAATGGGG - Intronic
1090253159 11:125264867-125264889 GTCCTCCCATTTCACAGATGGGG - Intronic
1090953353 11:131493653-131493675 GTACCCCCATTTCACAGATGGGG + Intronic
1091418099 12:308157-308179 CTTTGCCCATTTCACACTTGAGG - Intronic
1092507011 12:9112687-9112709 CTTCTGCCATTTTACAAATGGGG + Intronic
1093190895 12:16074005-16074027 CTATCCCCATTTCACAGATGAGG + Intergenic
1093980291 12:25468345-25468367 CTCCACCCATTTTATAGATGGGG - Intronic
1094175716 12:27538826-27538848 CTGCCCCTATTTGACAAATGAGG - Intronic
1094216360 12:27947007-27947029 CTCCACCCATTCAACAAATATGG - Intergenic
1095823032 12:46500258-46500280 CTCAGCCCATTTAAAAAATTGGG + Intergenic
1096464080 12:51838599-51838621 CACCCCCCATTTCACAATGGAGG - Intergenic
1096934733 12:55258925-55258947 ATGCACCCAATTCACAAATGGGG - Intergenic
1097180875 12:57171201-57171223 CTCAGCTCATTTCATAAAGGAGG - Intronic
1098602082 12:72344224-72344246 TTATGCCCATTTCAGAAATGTGG - Intronic
1098933247 12:76446050-76446072 TTCCCCCCATTTTACAAATGAGG - Intronic
1099083312 12:78214081-78214103 CTATGCCCATTTTATAAATGAGG - Intergenic
1099441928 12:82709165-82709187 CTGCAACCATTTGACAAATGGGG - Intronic
1100629217 12:96370283-96370305 CTCTACCCATTTTACAAAAGAGG + Intronic
1101324974 12:103707383-103707405 CTATGCCCATTTTACAGATGAGG + Intronic
1101747367 12:107553349-107553371 CTCTTCCCATTTTACAGATGAGG + Intronic
1102205683 12:111089325-111089347 CTCCCCCCATTTCTCAGATGGGG - Intronic
1102258102 12:111427892-111427914 TTAGGCCCATTTCACAGATGGGG + Intronic
1102327728 12:112002665-112002687 TTAGGCCCATTTCACAAAAGAGG - Intronic
1102522310 12:113486069-113486091 TTCCATCCATTTCACAGATGAGG + Intergenic
1102556523 12:113730433-113730455 TCCCTCCCATTTCACAGATGAGG + Intergenic
1102956392 12:117061745-117061767 CTGCACCCATCTCACAGATGAGG - Intronic
1103370709 12:120417023-120417045 CCCTGCCCATTTCACAGATATGG - Intergenic
1103961882 12:124614003-124614025 TCACGCCCATTGCACAAATGGGG - Intergenic
1103962563 12:124618087-124618109 TCACGCCCATTGCACAAATGGGG + Intergenic
1104149911 12:126072308-126072330 TTAGGCCCATTTCACAGATGAGG - Intergenic
1105838908 13:24236297-24236319 CTCTGCCCATTTTTTAAATGGGG - Intronic
1107226683 13:38057841-38057863 CTGCTCCCATTTTACAGATGAGG - Intergenic
1107708117 13:43127027-43127049 CAGCTCCCATTTCACAAAGGGGG - Intergenic
1107861223 13:44662715-44662737 ATCCTCTTATTTCACAAATGAGG + Intergenic
1107964932 13:45589556-45589578 CTCTCCCCATTTTACAGATGAGG + Intronic
1108473904 13:50794395-50794417 GTCCTCCCATTTTACAAAAGGGG + Intronic
1108526367 13:51288849-51288871 CTCCTCCCACTTTGCAAATGAGG - Intergenic
1108712148 13:53044058-53044080 ATTCTCCCATTTTACAAATGAGG - Intronic
1108926615 13:55755915-55755937 CCCCATCCTTTTCACAAATGAGG - Intergenic
1110185106 13:72664830-72664852 TTATGCCCATTTTACAAATGAGG + Intergenic
1110229929 13:73157442-73157464 CCCGTCTCATTTCACAAATGAGG + Intergenic
1112378834 13:98869344-98869366 CTCTGACCCTTTAACAAATGAGG - Intronic
1112795786 13:103055159-103055181 CTCCACCCATTTTACAAATGAGG - Intronic
1113172068 13:107515761-107515783 CTCCAACCAATCCACAAATGAGG - Intronic
1115213866 14:30995459-30995481 TTCCTCTCATTTGACAAATGAGG - Intronic
1115366821 14:32567247-32567269 CTCCCTCCATTTTACAGATGAGG - Intronic
1115724038 14:36193801-36193823 CATCGCTCATTTTACAAATGAGG + Intergenic
1116419107 14:44712750-44712772 AGCCAACCATTTCACAAATGGGG + Intergenic
1117212748 14:53518018-53518040 CTTCTCCCATTTCACAGAAGAGG + Intergenic
1117320570 14:54619395-54619417 CTCAGCCCATTTCACATAGCAGG + Intronic
1117959692 14:61150496-61150518 TTGCCCCCATTTCACAGATGAGG + Intergenic
1119126860 14:72135402-72135424 ATCCTCACATTTCACAGATGAGG - Intronic
1119308208 14:73624776-73624798 TTACGCCCATTTCATAGATGAGG - Intergenic
1119397628 14:74339265-74339287 CTCGCCCCATTTCACAGATGAGG + Intronic
1119730962 14:76950905-76950927 TTCTCCCCATTTCACACATGAGG + Intergenic
1120032717 14:79660823-79660845 CTCTGCCCACCCCACAAATGAGG - Intronic
1121013001 14:90533028-90533050 TTCTCCCCATTTCACAGATGAGG + Exonic
1121444487 14:93969965-93969987 CTTTTCCCATTTCACAGATGTGG - Intronic
1121724116 14:96133714-96133736 TTTCTCCCATTTTACAAATGAGG - Intergenic
1122035275 14:98944563-98944585 CTCTCCCCATTTTACAGATGAGG - Intergenic
1122151931 14:99730330-99730352 CCACCCCCATTTCACAGATGGGG + Intergenic
1122156647 14:99754087-99754109 CTTCCCCCATTTCACAGATCAGG - Intronic
1122411663 14:101528868-101528890 CTCAGCCCACTGCACAGATGGGG + Intergenic
1122521010 14:102343767-102343789 CTCCTCACATTTTACAGATGAGG + Intronic
1122543630 14:102510682-102510704 CTAGGCCCATTTTACAGATGTGG + Intergenic
1122628890 14:103098443-103098465 ATTTGCCCATTTCACAGATGAGG - Intergenic
1123485336 15:20730771-20730793 CTCCGCCCATTTTAAAAATTTGG + Intergenic
1123541824 15:21299820-21299842 CTCCGCCCATTTTAAAAATTTGG + Intergenic
1123668201 15:22626984-22627006 ATCCGTCCAACTCACAAATGGGG - Intergenic
1123760019 15:23424735-23424757 CCCCGTCCATTTCACAGATCAGG - Intergenic
1124524178 15:30433423-30433445 ATCCGTCCAGCTCACAAATGGGG - Intergenic
1124534488 15:30532793-30532815 ATCCGTCCAGCTCACAAATGGGG + Intergenic
1124642021 15:31401668-31401690 TTGTGCCCATTTTACAAATGGGG + Intronic
1124764160 15:32474806-32474828 ATCCGTCCAGCTCACAAATGGGG - Intergenic
1124774474 15:32574251-32574273 ATCCGTCCAGCTCACAAATGGGG + Intergenic
1124877404 15:33608168-33608190 CTGTGCCCATTTTACAGATGGGG + Intronic
1125072288 15:35569644-35569666 CTAAGCCCATTTCAAAAATCAGG + Intergenic
1125083308 15:35700594-35700616 GTCTCCCCATTTTACAAATGGGG - Intergenic
1125927543 15:43575409-43575431 TTCCTCCCATTTTACAGATGAGG - Intronic
1125940686 15:43674974-43674996 TTCCTCCCATTTTACAGATGAGG - Intergenic
1126012319 15:44314836-44314858 TTTTCCCCATTTCACAAATGAGG - Intronic
1126186035 15:45831227-45831249 GTCCTCTCATTTTACAAATGAGG - Intergenic
1126630610 15:50730936-50730958 CTTCACCCATTTCAAAAATATGG + Intronic
1127668267 15:61170095-61170117 CTCAACCCACTTGACAAATGAGG - Intronic
1127753763 15:62069655-62069677 CTATGCCCATTTTACAGATGAGG + Exonic
1127931308 15:63599402-63599424 TTCCTCCCACTTGACAAATGAGG + Intronic
1128350131 15:66882860-66882882 CTGCACCCATTTTTCAAATGAGG - Intergenic
1128672880 15:69587410-69587432 TTATTCCCATTTCACAAATGAGG - Intergenic
1128713062 15:69886347-69886369 TTCATCCCATTTCACAGATGGGG - Intergenic
1129207574 15:74046089-74046111 ATCAGCCCATTTTACAGATGGGG - Exonic
1129518784 15:76172683-76172705 CTCCCCTCATTTGACAGATGGGG + Intronic
1129694344 15:77732111-77732133 CTGTGCCCATTTCACAGATGAGG + Intronic
1129756523 15:78102396-78102418 ATCAGCCCATTTTACAGATGAGG - Intronic
1130293883 15:82629195-82629217 CTTTTTCCATTTCACAAATGGGG - Intronic
1130323188 15:82856989-82857011 TTCCCCCCATTTTACAGATGAGG - Intronic
1130628165 15:85537753-85537775 TTTCCCCCATTTCACAGATGAGG - Intronic
1130746144 15:86655968-86655990 CTACTCCCATTTTACACATGAGG - Intronic
1132143241 15:99411579-99411601 CTACTCCCATTTTACAGATGAGG - Intergenic
1202950139 15_KI270727v1_random:26962-26984 CTCCGCCCATTTTAAAAATTTGG + Intergenic
1132555196 16:569229-569251 CTCCTCCCATTTTACAAGTGGGG + Exonic
1132895432 16:2226959-2226981 CCCAGCCCATTTTACAGATGAGG + Intronic
1133148281 16:3807063-3807085 CACCTTCCATTTCACAAAAGTGG + Intronic
1133579049 16:7125282-7125304 CTATGCCCACTGCACAAATGAGG - Intronic
1133595611 16:7288418-7288440 CTCCTCCCATTTCACAGGTAAGG - Intronic
1133597072 16:7303641-7303663 CTGGACCCATTTGACAAATGAGG + Intronic
1133695081 16:8255466-8255488 CTCCTCCCATTCTACAAATCAGG - Intergenic
1133815723 16:9195916-9195938 CACAGGCCATTTCACACATGGGG - Intergenic
1134021913 16:10927062-10927084 TTATGCCCATTTTACAAATGAGG - Exonic
1134093012 16:11401562-11401584 CTCAGTCCATTTCACAGAGGAGG + Intronic
1134504539 16:14794303-14794325 TTATGCCCATTTCACAGATGAGG - Intronic
1134576032 16:15334606-15334628 TTATGCCCATTTCACAGATGAGG + Intergenic
1134726410 16:16421895-16421917 TTATGCCCATTTCACAGATGAGG - Intergenic
1134806816 16:17132991-17133013 CTCTTCTCATTTCACAGATGAGG + Intronic
1134846877 16:17447796-17447818 ATTCTCCCATTTTACAAATGTGG - Intronic
1134941021 16:18289964-18289986 TTATGCCCATTTCACAGATGAGG + Intergenic
1135705551 16:24671600-24671622 CTGCGCCCATTTCACAGATGGGG + Intergenic
1135899171 16:26440782-26440804 CTTCTCCCATTTCACATATAAGG + Intergenic
1135966162 16:27036960-27036982 TTCCCTCCATTTCACAAATGGGG - Intergenic
1135982516 16:27159298-27159320 TTACCCCCATTTTACAAATGAGG - Intergenic
1136009576 16:27354673-27354695 CTCCTCCCATTATACAGATGGGG - Intronic
1136017004 16:27406782-27406804 CTGCCCCCATTCCACAGATGAGG + Intronic
1136072007 16:27792874-27792896 TTCTGCCCATTTTACAGATGAGG + Intronic
1136136715 16:28260632-28260654 ATCCTCCCATTTTACAGATGAGG - Intergenic
1136320122 16:29478688-29478710 TACCCCCCATTTCACAGATGAGG + Intergenic
1136434693 16:30218029-30218051 TACCCCCCATTTCACAGATGAGG + Intergenic
1136464006 16:30429712-30429734 CTGCGCCCATTTTGCAGATGAGG + Intronic
1136545374 16:30951349-30951371 CTCTGGCCATTTTACAGATGAGG + Intronic
1137967576 16:52952090-52952112 ATTTGCCCATTTCACAAATGAGG + Intergenic
1138136933 16:54531383-54531405 CTCCTCCCATTATACAGATGGGG - Intergenic
1138210999 16:55163567-55163589 ATCGGCCCATTTCACAGATGAGG - Intergenic
1138220412 16:55245579-55245601 CTGCTCCCATTTCAAAGATGAGG - Intergenic
1138250567 16:55498832-55498854 TTCCTCCCATTTTACAGATGAGG + Intronic
1138567353 16:57843401-57843423 GTTGGCCCATTTCACAAAGGAGG + Intronic
1139368758 16:66451692-66451714 CTGCTCCCATTTTACAGATGAGG + Intronic
1139754155 16:69129584-69129606 TCACTCCCATTTCACAAATGAGG + Intronic
1140350838 16:74260731-74260753 CTGTGCCCATTCCACATATGGGG + Intergenic
1141194003 16:81845968-81845990 CTGCCCCTATTTTACAAATGAGG - Intronic
1141385900 16:83622187-83622209 TTGTGCCCATTTCACAGATGAGG + Intronic
1141470321 16:84233938-84233960 CTACCCCCATTTTACAGATGAGG - Intronic
1141644281 16:85358949-85358971 TTCTTCCCATTTCCCAAATGAGG - Intronic
1141661897 16:85445936-85445958 ATTTGCCCATTTCACAGATGGGG - Intergenic
1141672950 16:85502419-85502441 CTCCTCCCATTTTACCAATGGGG + Intergenic
1141768035 16:86071539-86071561 CTCCTCCCATTTCACAGATGAGG - Intergenic
1141802293 16:86318254-86318276 TTCTGCCCATTTTACAAGTGAGG - Intergenic
1142469614 17:156031-156053 GCCAGCCCATTTCACAGATGGGG - Intronic
1142743418 17:1943167-1943189 CAGCCCCCATTTCACAAAGGAGG + Intronic
1143881371 17:10032536-10032558 ATCCCCCCATTTCACAGATGAGG - Intronic
1144390791 17:14791585-14791607 CAACGTCCACTTCACAAATGAGG + Intergenic
1144582205 17:16465362-16465384 ATCTGCCCATTTCACAGATAGGG - Intronic
1144764914 17:17727413-17727435 CCCTGCCCATTTCACAGATGGGG + Intronic
1146299916 17:31679806-31679828 CTCTCCCCATTTTACAGATGTGG + Intergenic
1146372389 17:32273304-32273326 GTCCGCTCATTTTGCAAATGAGG + Intronic
1146638889 17:34525641-34525663 ATTTTCCCATTTCACAAATGGGG - Intergenic
1147045921 17:37752117-37752139 CTACCCACATTTCACAGATGAGG + Intergenic
1147388281 17:40094489-40094511 CTCAGCCCCTTTCACCAATCAGG + Intronic
1147510277 17:41062640-41062662 CTCTGCCCATTTTACAGATGAGG - Intergenic
1147851144 17:43443846-43443868 CTCTTCCCATTTTATAAATGAGG - Intergenic
1147899940 17:43777586-43777608 CTCCTCCCATTTTACAGAGGAGG - Intronic
1148219173 17:45850075-45850097 CTCTGCCCATTTCACAGATGGGG + Intergenic
1148355802 17:46974836-46974858 CTCCTCCCATTGTACAGATGAGG - Intronic
1148736408 17:49867679-49867701 CTTCTCCCATTTTACAAATGAGG + Intergenic
1148770227 17:50062240-50062262 CTGCCCCCATTTTACAGATGGGG + Intronic
1148973042 17:51501016-51501038 ATACTCCCATTTCACAAATGAGG - Intergenic
1149583805 17:57770800-57770822 CTACTCCCATTTCATAGATGAGG + Intergenic
1149982047 17:61318494-61318516 CTCCCCCTAATTGACAAATGTGG + Intronic
1150288346 17:63966604-63966626 CTGCGCCCATTGCACACCTGTGG + Intronic
1150651951 17:67016215-67016237 CTCTGCCCATTCTACAGATGAGG + Intronic
1151208879 17:72528857-72528879 GTCTGCCCATTTTACAGATGAGG + Intergenic
1151352593 17:73540677-73540699 CTCTTCCCATTTGATAAATGAGG + Intronic
1151796882 17:76352792-76352814 CCATGCCCATTTCACAGATGAGG + Intronic
1151917071 17:77126265-77126287 CACAGCCCATTTCGCAGATGGGG - Intronic
1152009653 17:77704370-77704392 CTGTGCTCATTTCACAGATGAGG + Intergenic
1152112193 17:78363070-78363092 CTCCAACCATTTTACAAATAAGG - Intergenic
1152475923 17:80518273-80518295 CTCACCCCATCTCACAAATAAGG + Intergenic
1152665601 17:81567258-81567280 CTCTGCCCATAGGACAAATGAGG + Intronic
1155560291 18:27068784-27068806 CCAGGCCCCTTTCACAAATGTGG + Intronic
1156489709 18:37488910-37488932 CTCTTCCCATTTTACAGATGAGG - Intronic
1156604769 18:38653475-38653497 TTCCGTCCATTTCATAAATGTGG - Intergenic
1156877777 18:42036755-42036777 CTCCTCTCATTTTATAAATGAGG + Intronic
1157426012 18:47584866-47584888 CTCCTCCCATTTCACAAGGCTGG - Intergenic
1158399965 18:57113270-57113292 CTCTCCCCATTTTATAAATGGGG + Intergenic
1158427582 18:57353274-57353296 CTTCCCTCATTTCAGAAATGGGG + Intronic
1158549032 18:58419414-58419436 TTCCACCTATTACACAAATGTGG + Intergenic
1158930605 18:62321902-62321924 CTACTTCCATTTTACAAATGAGG - Intergenic
1159217607 18:65415518-65415540 CTCCACCGATTTCCCTAATGTGG + Intergenic
1159813292 18:73042743-73042765 CTATGCCCATTTCATAAATGAGG - Intergenic
1160985407 19:1836336-1836358 GTCAGCCCATTTCAAAGATGAGG + Intronic
1161042049 19:2115491-2115513 CACAGCCCATGTGACAAATGCGG + Intronic
1161280467 19:3442829-3442851 CTGCGCCCATTTCACAGATGTGG - Intronic
1161398685 19:4058359-4058381 CTCTGCCCATTTGACAGATAGGG - Intronic
1161482087 19:4516392-4516414 CTGCACCCATTTCACAGATGTGG + Intronic
1162145881 19:8611726-8611748 CTGGTCCCATTTCACAGATGAGG + Intergenic
1162332959 19:10041584-10041606 TTCCACCCATTTCTCTAATGAGG - Intergenic
1162380809 19:10330629-10330651 CACCCCCCATTTTACCAATGAGG + Intronic
1162530061 19:11230806-11230828 CTATACCCATTTCACAGATGGGG - Intronic
1162589125 19:11579064-11579086 ATCGGCCCATTTTACAGATGCGG - Intronic
1162802097 19:13116889-13116911 CTAGTCCCATTTCACAGATGAGG + Exonic
1163351397 19:16778148-16778170 CACCACCCATTTTACACATGTGG + Intronic
1163403634 19:17109462-17109484 CTCTGCCCATTTTAAAGATGAGG + Intronic
1163453840 19:17394378-17394400 CTCTCCCCATTTCACAAAGGGGG - Intergenic
1163460740 19:17436036-17436058 CTCCATCCATTTCACAGATGAGG - Exonic
1164580803 19:29433742-29433764 CTCTGACCATTTTACAGATGGGG - Intergenic
1165809721 19:38605194-38605216 TATCCCCCATTTCACAAATGGGG - Intronic
1165927248 19:39334743-39334765 TTCTCCCCATTTCACAGATGAGG + Intronic
1166341708 19:42141421-42141443 CTGCCCCCATTTCACAGATGAGG - Intronic
1166647253 19:44541286-44541308 CTCCCCCCATTTTACAGATTGGG + Intergenic
1166992109 19:46698869-46698891 GGCAGCCCATTTCACAGATGGGG - Intronic
1167740500 19:51322318-51322340 CTCCACCCCTTTGACAGATGGGG - Intronic
1168079740 19:54000878-54000900 CTTCCCCCATTTTATAAATGAGG + Intronic
1168397389 19:56060248-56060270 CCGCCCCCATTTCACAGATGGGG - Intronic
925189860 2:1874289-1874311 CCGTGCCCATTTCACAGATGGGG - Intronic
925233880 2:2260243-2260265 CAATGCCCATTTCACAGATGGGG - Intronic
926138331 2:10353175-10353197 CACTGCCCATTTGACAGATGAGG - Intronic
926252272 2:11161863-11161885 CTCAAGCCATTTCACAGATGTGG - Intronic
927455568 2:23246441-23246463 CTCCTGTCATTTCATAAATGAGG + Intergenic
927961751 2:27244755-27244777 TTCCACCCATTTCACAGATGTGG + Intergenic
928135880 2:28687087-28687109 CTCCGCCCATTTCTCCAACCTGG - Intergenic
928912670 2:36438711-36438733 CTCCTTCCCTTTCAGAAATGTGG - Intronic
929588010 2:43128083-43128105 ATCCTCCCATTTGACAGATGAGG + Intergenic
931462175 2:62458528-62458550 CTCTGCCCATTTTGCAGATGGGG - Intergenic
932806161 2:74785250-74785272 ATCCCCTCATTTTACAAATGAGG - Intergenic
932901138 2:75701436-75701458 CTGCCCTCATTTCACAAATGAGG + Intronic
933862852 2:86487492-86487514 CACCCCCCATTTTGCAAATGAGG + Intronic
933892599 2:86785569-86785591 CCCCGCCCGTTTTACAAAGGGGG - Exonic
934990814 2:98920395-98920417 CTCTGCAGCTTTCACAAATGGGG + Intronic
935334211 2:102000283-102000305 GTATGCCCATTTCACAGATGAGG + Intronic
936054793 2:109254374-109254396 CTGCCCCCATTTTACAGATGGGG - Intronic
937465904 2:122132832-122132854 CTTCTCCCATTGCACAGATGAGG - Intergenic
937954697 2:127415652-127415674 CTGACCCCATTTTACAAATGTGG + Intergenic
937955423 2:127419426-127419448 TTCCATCCATTTTACAAATGAGG + Intronic
938745823 2:134277213-134277235 TTTCCCCCATTTTACAAATGGGG - Intronic
938973517 2:136453813-136453835 TTATGCCCATTTTACAAATGAGG + Intergenic
938978258 2:136500389-136500411 CTGCCCCCATTTTACAGATGAGG - Intergenic
939253506 2:139714084-139714106 ATGCACCCATTTAACAAATGAGG - Intergenic
939986370 2:148833333-148833355 TTGCCCCCATTTTACAAATGAGG - Intergenic
940102569 2:150058484-150058506 ATACCCCCATTTTACAAATGAGG - Intergenic
940652427 2:156451835-156451857 CTCCGCCCATCTGAGAAGTGAGG - Intronic
941074667 2:160993098-160993120 TTACTCCCATTTCACAGATGAGG + Intergenic
941102385 2:161310533-161310555 GTTCTCCCATTTCACAAATAAGG - Intronic
942137612 2:172943424-172943446 TTACTCCCATTTCACAGATGAGG - Intronic
942167001 2:173251460-173251482 CTGCCCCCATTTTACAGATGAGG - Intronic
942310576 2:174653091-174653113 CTGGGCCCATTTTACAAATAAGG + Intronic
942727215 2:179023291-179023313 CTACCTCCATTTCACAGATGAGG + Intronic
942972412 2:181972179-181972201 CTCAGCCAAATTCACTAATGTGG + Intronic
943113799 2:183641078-183641100 ATCCTCACATTTCACAGATGAGG + Intergenic
943761571 2:191615184-191615206 CTCTCCCCACTTCACAGATGGGG - Intergenic
944299479 2:198106821-198106843 CTCTCTCCATCTCACAAATGAGG + Intronic
944984487 2:205159822-205159844 CACTGCTAATTTCACAAATGAGG - Intronic
945170099 2:206986756-206986778 CTGCTCCTATTTTACAAATGAGG - Intergenic
945769449 2:214022424-214022446 CTATGCACATTTTACAAATGAGG - Intronic
945797688 2:214385240-214385262 TTCACCCCATTTTACAAATGAGG - Intronic
946177446 2:217930181-217930203 ATCAGTCCATTTCACAGATGAGG + Intronic
946248025 2:218398291-218398313 CTTAACCCATTTCACAGATGAGG - Intronic
947162572 2:227228983-227229005 CTGACCCCATTTCACAGATGTGG + Intronic
947477930 2:230468108-230468130 TTCCCCCCATTTGACAGATGGGG + Intronic
947624837 2:231612988-231613010 CTGCTCCCATTTTACAGATGAGG + Intergenic
947680517 2:232027458-232027480 ATCCCCTCATTTTACAAATGAGG - Intronic
947831097 2:233142403-233142425 CTGTCCCCATTTCACAGATGGGG - Intronic
948323465 2:237091344-237091366 CTAATCACATTTCACAAATGAGG - Intronic
1168750452 20:278042-278064 GTCCTCCCATTTTACAGATGAGG - Intronic
1168947516 20:1773860-1773882 CTATCCCCATTTCACAGATGAGG + Intergenic
1168961388 20:1872377-1872399 GTCCTCCCATTTTACAGATGAGG - Intergenic
1169017071 20:2300672-2300694 CTGTCCCCATTTCACAGATGAGG - Intronic
1169257289 20:4109178-4109200 CTGCTCCCATTTCATAGATGAGG - Intergenic
1170212632 20:13860587-13860609 CTCTGCCCACTTCCTAAATGTGG + Intronic
1172030644 20:31979877-31979899 CTGCACCCATTTCACAGATGGGG + Intronic
1172110095 20:32539451-32539473 CTGAACCCATTTCCCAAATGAGG - Intronic
1172121230 20:32599982-32600004 ATTCCCCCATTTCACAGATGAGG - Intronic
1172134711 20:32679240-32679262 CTGCTCCCATTTCAGAGATGGGG + Intergenic
1172298333 20:33829998-33830020 CCACTCCCATTTTACAAATGAGG + Intronic
1172430349 20:34885448-34885470 CTCCTCTCATTTTACAGATGGGG - Intronic
1172837296 20:37881227-37881249 GTCCCCCCATATCACAGATGAGG - Intergenic
1172876558 20:38167915-38167937 CTGCCCCCATTTTACAAATGAGG - Intergenic
1172882130 20:38208955-38208977 ATCCCTCCATTTCACAGATGGGG + Intergenic
1172896815 20:38305737-38305759 CTACCCCCATTTCACAGATAAGG - Intronic
1172897195 20:38308634-38308656 CTGTGCCCATTTTACAGATGAGG + Intronic
1173312908 20:41916484-41916506 CTCTCCCCATTTCCCAAATTGGG - Intergenic
1173572718 20:44087865-44087887 TTACGCCCATTTTACAAATGAGG - Intergenic
1173606848 20:44337583-44337605 ATCTGCCCATTTTACAGATGAGG + Intronic
1173841834 20:46162564-46162586 CTCCACCCATTCCCCAAAAGAGG - Intergenic
1173865601 20:46310685-46310707 ATTAGCCCATTTTACAAATGAGG + Intergenic
1173868454 20:46327737-46327759 CTGCACCCATTTCACCGATGGGG - Intergenic
1173933176 20:46838722-46838744 CTATTCCCATTTCACAGATGAGG - Intergenic
1174282409 20:49448845-49448867 AACCCTCCATTTCACAAATGAGG + Intronic
1174363433 20:50042511-50042533 CTGTCCCCATTTCACAGATGTGG + Intergenic
1174528376 20:51191576-51191598 TTATGCCCATTTGACAAATGAGG - Intergenic
1174870583 20:54177467-54177489 CACTGTCCATTTAACAAATGCGG - Intergenic
1175112943 20:56661677-56661699 GTTAGCCCATTTCACAGATGAGG + Intergenic
1175251220 20:57611164-57611186 CTCTGCTCATTTTACAAATGAGG + Intronic
1175258039 20:57658622-57658644 GTCAGCCCATTTTACAAATGGGG + Intronic
1175301020 20:57942763-57942785 CTGTGCCCGTTTCACAGATGTGG - Intergenic
1175888561 20:62305932-62305954 CTCCGCCCATTTCACAAATGGGG - Intronic
1176261454 20:64183106-64183128 TTCTGGCCATTTCACAAATATGG + Intronic
1177653797 21:23989896-23989918 TTACTCCCATTTCACAGATGAGG - Intergenic
1178304860 21:31482957-31482979 TTGCGCCCATTTTACAGATGAGG + Intronic
1178977566 21:37232640-37232662 CTCCCCTCATTTTACAGATGAGG - Intronic
1179288131 21:39995612-39995634 CTACCCCCATTTTACAAGTGAGG - Intergenic
1179518372 21:41925597-41925619 CCCCGTCCATTTGGCAAATGGGG - Intronic
1180593313 22:16958249-16958271 CTCCACCCACTGCACAAGTGGGG - Intergenic
1181878109 22:25955787-25955809 TTGCCCCCATTTCACAGATGAGG + Intronic
1181882429 22:25991694-25991716 CTTCTCCCATTTCACAGATGAGG - Intronic
1181952527 22:26564738-26564760 TTCTCCCCATTTGACAAATGGGG + Intronic
1181971862 22:26696989-26697011 CTCCGCCCATTAAAAAAATGGGG + Intergenic
1182072980 22:27476409-27476431 CTACCCCCATCTTACAAATGAGG + Intergenic
1182076745 22:27500105-27500127 CTGTGCCCATTTTACAGATGAGG - Intergenic
1182081605 22:27533268-27533290 ATCAGCCCATTTCACAGATGTGG + Intergenic
1182259678 22:29064378-29064400 CTAGGCCCATTTCACAGCTGAGG - Intergenic
1182360535 22:29744022-29744044 ATCCTCCCATTTGACATATGGGG - Intronic
1183071102 22:35396869-35396891 CTATTCCCCTTTCACAAATGAGG - Intergenic
1183232548 22:36592058-36592080 CTGCACCCATGCCACAAATGTGG - Intronic
1183284266 22:36952542-36952564 CGACGCCCAGTTCACAGATGGGG - Intergenic
1183304862 22:37077192-37077214 CTCATCCCATTTTACAGATGAGG + Intronic
1183666940 22:39251579-39251601 CCACCCCCATTTCACAAATGGGG + Intergenic
1184175389 22:42786037-42786059 CAACGCCCATTTCACAGGTGGGG - Intergenic
1184246641 22:43239134-43239156 ATTCCCCCATTTCACAGATGGGG - Intronic
1184279724 22:43430070-43430092 TTCCTCTCATTTTACAAATGGGG - Intronic
1184388305 22:44188632-44188654 CTGTCCCCATTTCACAGATGAGG + Intronic
1184404801 22:44293700-44293722 CTCAGCCCATTTTACAGATGAGG - Intronic
1184405740 22:44299416-44299438 CTCAGCCCATTTTACAAATGAGG - Intronic
1184691165 22:46117967-46117989 CTCAGCCCATTTCATGAATGTGG + Intergenic
1184713729 22:46268395-46268417 CTGAGCCCATTTTACAGATGAGG + Intronic
1184715846 22:46281379-46281401 CACTGCCCAGTTCACAGATGAGG - Intronic
1184726124 22:46347697-46347719 CTCATCCCGTTTCACAGATGAGG + Intronic
1184849356 22:47111108-47111130 CTCCTCCCACTCCACAGATGAGG - Intronic
949688191 3:6602139-6602161 ATTCTCCCATCTCACAAATGGGG - Intergenic
949859102 3:8489380-8489402 GTACTCCCATTTCACAGATGAGG - Intergenic
949975683 3:9456510-9456532 CTATTCCCATTTTACAAATGAGG - Intronic
950106755 3:10393468-10393490 CTCACCCCATTTCACAGATAGGG + Intronic
950108341 3:10402541-10402563 CGCTGCCCATTTCACAGATGTGG + Intronic
950121474 3:10484906-10484928 TTCAGCCCATTTCACAGCTGAGG - Intronic
950447801 3:13048175-13048197 CTACTCCCATTTTACACATGAGG - Intronic
950525494 3:13520533-13520555 TCCCTCCCATTTCACAGATGAGG - Intergenic
950644868 3:14371108-14371130 CATTGCCCATTTCACAGATGAGG - Intergenic
950659416 3:14457650-14457672 CAGTGCCCATTTCACAGATGAGG + Intronic
951319257 3:21225442-21225464 TTCAGCCCATTTGACAGATGAGG - Intergenic
951698708 3:25472558-25472580 CCCCCTCCATTTCACAGATGAGG + Intronic
951710410 3:25580884-25580906 TTCAGCCCATTTCACAGATAAGG - Intronic
951851443 3:27145734-27145756 CTACCCCCATTTTACAGATGAGG + Intronic
952161239 3:30695487-30695509 CTATGCCCATTTAACAGATGAGG + Intergenic
953890108 3:46744903-46744925 CTCTTCCCATTTCAGAGATGGGG + Intronic
954676207 3:52316858-52316880 CTGGCCCCATTTCACAGATGGGG - Intronic
954797407 3:53168600-53168622 ATCTGCCCATTTCACAGACGAGG - Intronic
955331762 3:58053030-58053052 GTCAGCCCATTTTACAGATGAGG + Intronic
955990194 3:64618585-64618607 TTCCCTCCATTTCACAGATGAGG - Intronic
956105036 3:65808715-65808737 CTCCACCCACCTCACAAATTGGG + Intronic
956251956 3:67243831-67243853 CTCAGACCCTTTAACAAATGAGG + Intergenic
956285028 3:67599132-67599154 CTAAGCCCATTTTACAGATGAGG + Intronic
956641861 3:71423223-71423245 TTAAGCCCATTTCACAGATGAGG + Intronic
956695862 3:71919025-71919047 ATCCTCCCATTTTACAAGTGAGG + Intergenic
956877685 3:73479765-73479787 CAACTCCCCTTTCACAAATGTGG + Intronic
958833751 3:99119665-99119687 ATCCTCCCATTTTGCAAATGAGG + Intergenic
962445207 3:135457691-135457713 CTATGCCCATTTTACAGATGAGG - Intergenic
962908117 3:139823675-139823697 CTCCTCCCATTTTTCAGATGAGG - Intergenic
963853280 3:150228295-150228317 CTCCACCCATTGCACACATGAGG + Intergenic
963945545 3:151142144-151142166 GTGCCTCCATTTCACAAATGAGG + Intronic
964083893 3:152792384-152792406 ATCCCCCCATCACACAAATGAGG - Intergenic
964695180 3:159499815-159499837 CTACACCCATTTTATAAATGAGG + Intronic
965739973 3:171864100-171864122 CTATGCCCATTTCACAGATGAGG + Intronic
966945983 3:184777407-184777429 CTGCCCTCATTTCACAGATGAGG + Intergenic
967319112 3:188178182-188178204 ATCAGCCAATTTCACAGATGGGG + Intronic
967464419 3:189787346-189787368 CTGCCCTCATTTCACAAATGAGG + Intronic
967991936 3:195137998-195138020 GTCTCCCCATTTCACAGATGAGG + Intronic
967994916 3:195159290-195159312 CTCTACCCATTTTACAGATGAGG + Intronic
968653274 4:1768219-1768241 CTCCGGCCCTCTCACATATGCGG + Intergenic
968808911 4:2791486-2791508 CCCCCTCCATTTCACAGATGGGG + Intergenic
968863676 4:3193577-3193599 CTCCTTCCATCTCACAATTGAGG + Intronic
968958873 4:3732672-3732694 TTCCTCCCATTTCACAGATCGGG - Intergenic
969080610 4:4615105-4615127 CTATGCCCATTTGACAGATGTGG + Intergenic
969175347 4:5394762-5394784 CTGTTCCCATTTCCCAAATGAGG + Intronic
969195709 4:5562243-5562265 ATCTTCCCATTTTACAAATGAGG - Intronic
969220312 4:5754756-5754778 TTATGCCCATTTCACAGATGTGG - Intronic
969220784 4:5757095-5757117 CTGTCCCCATTTCACAGATGGGG - Intronic
969243605 4:5918274-5918296 CACGTCCCATTTCACAGATGGGG + Intronic
969292873 4:6251989-6252011 ATCCAGCCATTTCACAGATGGGG + Intergenic
969313923 4:6370266-6370288 ATCACCCCATTTCACAGATGAGG - Intronic
969475480 4:7420312-7420334 CTGTGCCCATTTTACAGATGGGG - Intronic
969497732 4:7535507-7535529 CTACCCCCATTTCACCAATGAGG - Intronic
969531843 4:7734676-7734698 CACTGCCCATCTCACAGATGAGG + Intronic
969571506 4:8011487-8011509 CTTTGCCCATTTTACAGATGAGG - Intronic
969868399 4:10090297-10090319 CTGTGCCCATTTCACCAATGAGG + Intronic
972321671 4:37977735-37977757 CGGCGCCCATTTCACAGTTGGGG + Intronic
972656937 4:41072908-41072930 CTTAGCCCATTTTACAGATGAGG - Intronic
972787945 4:42345131-42345153 GTCTGCCCATTTTACAGATGAGG + Intergenic
973598752 4:52520102-52520124 ATCCCTTCATTTCACAAATGAGG - Intergenic
973650224 4:52991667-52991689 CTCCACCCAACTCCCAAATGAGG + Intronic
973954824 4:56051893-56051915 CTTCCCCCATTTTACAGATGAGG - Intergenic
974020652 4:56689051-56689073 TTCCCCTCATTTCACATATGAGG - Intergenic
974849441 4:67386835-67386857 CTATGCCCATTTTACACATGAGG - Intergenic
975249234 4:72158227-72158249 ATCACCCCATTTTACAAATGAGG - Intergenic
975553880 4:75640525-75640547 CCCATCCCATTTCACAAATAAGG + Intergenic
978369581 4:108016833-108016855 CTGCTCCTATTTTACAAATGGGG - Intronic
979439718 4:120736911-120736933 CTACTTCCTTTTCACAAATGAGG + Intronic
979823744 4:125206683-125206705 CTCAGTCCATTTTACAGATGAGG + Intergenic
980091909 4:128451638-128451660 GTCCTCTCATTTCACAGATGGGG + Intergenic
981503968 4:145480536-145480558 CTCTGAGCATTTCACATATGTGG + Intergenic
981902508 4:149883115-149883137 CACCCCCCATTTTACAGATGAGG - Intergenic
984689161 4:182706300-182706322 CTTCCCTTATTTCACAAATGAGG - Intronic
984846299 4:184110814-184110836 CACAGCCCATTTGATAAATGTGG - Intronic
984865025 4:184273871-184273893 CTTAGCCCATTTCACAGATGAGG + Intergenic
985364665 4:189215894-189215916 CTTCGTTCATTTAACAAATGTGG - Intergenic
986575121 5:9204605-9204627 TTCTTCCCATTTCACAGATGAGG + Intronic
987393939 5:17403073-17403095 CTCTTCTCATTTTACAAATGAGG + Intergenic
987923374 5:24311316-24311338 CTCTTCCCATTTCCCAAAAGAGG + Intergenic
989367244 5:40670435-40670457 CTCCGCCTGTTTTACAAATGAGG - Intergenic
989633668 5:43512105-43512127 CTACTCCCATTTTACAAATGAGG - Intronic
992341426 5:75827674-75827696 TTAAGCCCATTTTACAAATGAGG + Intergenic
992879382 5:81091145-81091167 TGCCTCCCATTTCACAGATGGGG - Intronic
994711013 5:103264019-103264041 CCCCAACCATTTCACAAATGAGG + Intronic
995046022 5:107649023-107649045 ATCCCCTCATTTCACAGATGAGG + Intronic
995221775 5:109656380-109656402 CTCACCCCATTTCTAAAATGAGG - Intergenic
995251869 5:110002721-110002743 CTTTCCCCAGTTCACAAATGAGG + Intergenic
996820564 5:127621764-127621786 CTCTGCATATTTTACAAATGAGG - Intergenic
996877714 5:128258147-128258169 CTTTGGCCATTTCACATATGAGG + Exonic
997465541 5:134085532-134085554 CTCTGCCCATTTTACAGATAAGG - Intergenic
997620105 5:135282747-135282769 CTCTGCCCATTTTAAAAATGGGG + Intronic
998132568 5:139658765-139658787 CTCTCCCCATTGCACAGATGGGG - Intronic
998888625 5:146722035-146722057 CTACCCCCATTTTACAGATGAGG + Intronic
999065983 5:148686069-148686091 ATTCACTCATTTCACAAATGGGG - Intergenic
999195206 5:149777279-149777301 CTCTGCCCACTTTACAGATGTGG + Intronic
999438139 5:151580353-151580375 CCAGCCCCATTTCACAAATGGGG - Intergenic
999953482 5:156675181-156675203 CTTGTCCCATTTCACAAATGAGG - Intronic
1000297696 5:159926576-159926598 CTCTGCCCATTTTATAAATAAGG + Intronic
1000339801 5:160268384-160268406 TTCTTCCCATTTCACAGATGAGG - Intronic
1000388559 5:160699620-160699642 CTCACTCCATTTCACAAATCTGG - Intronic
1000539953 5:162527333-162527355 CTAATCCCATTTTACAAATGAGG + Intergenic
1001156289 5:169275238-169275260 CTGCACCCATTTTACAGATGAGG + Intronic
1001251808 5:170152577-170152599 ATCCTCCTATTTCACAAATCAGG - Intergenic
1001522546 5:172404949-172404971 CTGCACCCATTTCACAGATGAGG - Intronic
1001528184 5:172443972-172443994 ATTAGCCCATTTCACAAATGTGG - Intronic
1001532640 5:172474965-172474987 TTCCTCCCATTTCACAGATGGGG + Intergenic
1001589740 5:172857191-172857213 CTAGCCCCATTTTACAAATGAGG - Intronic
1001704767 5:173733914-173733936 CTATGCCCACTTCATAAATGAGG + Intergenic
1001773199 5:174311161-174311183 CCACGCCCATTCCACAGATGAGG - Intergenic
1001777452 5:174339295-174339317 CTATTCCCATTTCACAGATGGGG + Intergenic
1002057622 5:176607696-176607718 ATCATCCCATTTCACAGATGAGG + Intronic
1002209997 5:177592814-177592836 ATCCGCCCATTTCACAGACCGGG - Intronic
1002270705 5:178070111-178070133 TTCCGCCTCTTTCACAGATGAGG - Intergenic
1003367844 6:5493653-5493675 CTGCTCCCATTTTATAAATGAGG - Intronic
1003521469 6:6862188-6862210 TTGCACCCATTTCACAGATGAGG - Intergenic
1004340837 6:14806111-14806133 CTCCCCTCATTCCACAAATACGG + Intergenic
1004448532 6:15725117-15725139 GTCACCCCACTTCACAAATGAGG - Intergenic
1005755529 6:28922377-28922399 GTTTGCCCATTTCACACATGAGG - Intronic
1006014464 6:31068712-31068734 CTCAGCTCACTTCACAAATTGGG - Intergenic
1006021881 6:31122163-31122185 ATACCCCCATTTCACAGATGAGG - Intronic
1006644119 6:35504474-35504496 CTCAGCCCATTTTATAGATGGGG - Intronic
1006749221 6:36366271-36366293 CTCAGCCCATTTCACAGGTGAGG + Exonic
1006837815 6:37009644-37009666 CTATCCCCATTTTACAAATGAGG - Intronic
1007099609 6:39236926-39236948 ATCAGCCCATTTTACAGATGAGG + Intergenic
1007171896 6:39869963-39869985 CTATGATCATTTCACAAATGGGG + Intronic
1007276055 6:40674785-40674807 TTATGCCCATTTTACAAATGAGG - Intergenic
1007307626 6:40919217-40919239 CTCCTCCCATTTCAACAAGGAGG + Intergenic
1007494080 6:42247444-42247466 ATGAGCCCATTTGACAAATGAGG + Intronic
1007658377 6:43466896-43466918 TTCTCCCCATTTCACAAGTGGGG - Intergenic
1007692895 6:43714362-43714384 GTTCTCCCATTGCACAAATGAGG + Intergenic
1007788524 6:44296051-44296073 TTGTCCCCATTTCACAAATGAGG + Intronic
1007826788 6:44606843-44606865 ATCAGCCCATTTCACAGATGAGG + Intergenic
1007850460 6:44797947-44797969 GTCAGTCCATTTTACAAATGAGG - Intergenic
1007890916 6:45290837-45290859 CTAGTCTCATTTCACAAATGAGG + Intronic
1007958285 6:45936572-45936594 TTACCCCCATTTCACAGATGAGG + Intronic
1009029892 6:58044217-58044239 CTACTCCCATTTTACAGATGAGG - Intergenic
1009205419 6:60795455-60795477 CTACTCCCATTTTACAGATGAGG - Intergenic
1012815838 6:104020963-104020985 CTCCCCTCATTCCACAAATGTGG + Intergenic
1013155184 6:107486540-107486562 ATACCCCCATTTCACAGATGAGG - Intergenic
1013289765 6:108709857-108709879 GTCATCCCATTTTACAAATGTGG + Intergenic
1013313347 6:108918198-108918220 CTCTTCCCATTCCACAAATGAGG - Intronic
1014926110 6:127272158-127272180 CTATACCTATTTCACAAATGAGG - Intronic
1015594166 6:134850411-134850433 CTACTCCCATTTTACAGATGAGG - Intergenic
1016428618 6:143959667-143959689 TTGTCCCCATTTCACAAATGAGG + Intronic
1017903078 6:158734908-158734930 GTTATCCCATTTCACAAATGAGG + Intronic
1018270398 6:162071214-162071236 CTGCCCCCATTTCACAGATGAGG - Intronic
1018371369 6:163171451-163171473 TTCTGCCCATTTTACAGATGAGG + Intronic
1019311630 7:364729-364751 ATACACCCATTTCACAGATGAGG + Intergenic
1019314572 7:378636-378658 CTGCGCCCATTTCACGACTGTGG + Intergenic
1019427331 7:983802-983824 CTCTTCCCATTTCACAGATGAGG - Intronic
1019511343 7:1419120-1419142 GTTCTCCCATTTCACAGATGGGG + Intergenic
1019567458 7:1691515-1691537 CCCTGCCCATTTTACAGATGAGG - Intronic
1019803209 7:3103868-3103890 CTGCTCCCATTTGACAGATGAGG + Intergenic
1021410677 7:20327006-20327028 CTAGCCCCATTTTACAAATGTGG - Intergenic
1023034264 7:36116930-36116952 CTGACCCCATTTCACAGATGAGG - Intergenic
1024262549 7:47582842-47582864 TTCCCCCGATCTCACAAATGGGG - Intergenic
1024692181 7:51815083-51815105 CTAACCCCATTTCACAGATGAGG - Intergenic
1024760445 7:52590484-52590506 CTCTCCCCATTTCACAGATAAGG - Intergenic
1025169908 7:56747118-56747140 GTCATCCCATTTCACATATGAGG - Intergenic
1025941190 7:66077046-66077068 TTACCCCTATTTCACAAATGAGG - Intronic
1026609338 7:71843694-71843716 CTAGTCCCATTTTACAAATGAGG - Intronic
1026972090 7:74474647-74474669 CTCTCCCCATTTTACAGATGAGG - Intronic
1027822115 7:83060183-83060205 GTCTGACCATTTCACCAATGAGG - Intronic
1030146305 7:106359612-106359634 CTACTCCCATTTTACAAATGGGG - Intergenic
1030271880 7:107677325-107677347 CTACTCCCATTTTACAATTGAGG - Intronic
1030680861 7:112432582-112432604 CTATCCCCATTTTACAAATGAGG + Intronic
1030864974 7:114690209-114690231 CTTTGCCCATTTAAAAAATGTGG + Exonic
1031570372 7:123351644-123351666 CCCCTCCTATTTCACAGATGAGG - Intergenic
1031735558 7:125355747-125355769 CTACCCATATTTCACAAATGTGG - Intergenic
1031956620 7:127948975-127948997 TTTCGCCCACTTCACACATGTGG + Intronic
1033883136 7:145912338-145912360 CTCTCCCCATTTTACTAATGAGG - Intergenic
1035078876 7:156199822-156199844 CTCCTCCCATTTCATGAAGGAGG + Intergenic
1035907824 8:3532535-3532557 CTACGTCCATTTCTCAAATAAGG - Intronic
1038760790 8:30383571-30383593 CTGCTCCCATTTCACGGATGAGG + Intergenic
1039216324 8:35275710-35275732 CTATGCCCATTTTACAGATGAGG - Intronic
1039441889 8:37600790-37600812 ATCCACCCATTTCACAGATTGGG + Intergenic
1039616214 8:38956853-38956875 CTTCCCCCATTTTACAGATGAGG - Intronic
1040072559 8:43200395-43200417 TCCCGCTCATTTCACAAGTGAGG - Exonic
1041733529 8:61086901-61086923 TTCTCCCCATTTCATAAATGAGG + Intronic
1042954366 8:74233378-74233400 CTACACCCATTTTACCAATGAGG + Intergenic
1043099691 8:76026649-76026671 ATTTGCCCATTTCACAACTGAGG - Intergenic
1043374613 8:79634684-79634706 CACCACCAATTTTACAAATGAGG - Intronic
1044010371 8:86986336-86986358 CTCTGCCCATTTTTCTAATGGGG + Intronic
1044847929 8:96399827-96399849 CTATGCCCATTTTACAAATGAGG + Intergenic
1045243913 8:100426260-100426282 TTCTTCCCATTTTACAAATGAGG - Intergenic
1045339536 8:101240754-101240776 CAACTCCCATTTCACAAATGAGG - Intergenic
1046856912 8:119042554-119042576 CTGGGCTCATTTCACAGATGAGG - Intronic
1047211690 8:122845749-122845771 CTCTGCCCATTTCACAGGTAAGG + Intronic
1047314201 8:123717224-123717246 CTGCTCCCATTTTACAGATGAGG - Intronic
1047320724 8:123779177-123779199 GTACCCCCATTTCACAGATGAGG + Intronic
1047486570 8:125336334-125336356 CTTCTCCCATTTTACAGATGGGG + Intronic
1047522846 8:125608700-125608722 CTATCCCCATTTCACAGATGAGG - Intergenic
1047815804 8:128460932-128460954 TCACGCCCATTTAACAAATGAGG - Intergenic
1047900097 8:129411408-129411430 GTTCCCCCATTTCTCAAATGAGG + Intergenic
1048037223 8:130688720-130688742 TTACGCCCATTTCACAGATAAGG - Intergenic
1048234321 8:132675248-132675270 CCCCGCCCATTTTACAGATTAGG + Intronic
1048342675 8:133552926-133552948 TTACTCCCATTTCACAGATGTGG + Intronic
1048380627 8:133862079-133862101 CTCAGCCCATTTGACATTTGGGG + Intergenic
1048496603 8:134940853-134940875 CTCTTCCCATTTTACAGATGAGG + Intergenic
1048990807 8:139759127-139759149 CTGTCCCCATTTCACAGATGAGG + Intronic
1049233277 8:141495191-141495213 CTTGGCCCATTTGACATATGAGG + Intergenic
1049238360 8:141524180-141524202 AGCCTCCCATTTCACAGATGAGG - Intergenic
1050106299 9:2170026-2170048 TTTCCCCCATTTTACAAATGAGG + Intronic
1050191599 9:3032317-3032339 CTGTCCCCATCTCACAAATGAGG + Intergenic
1050704336 9:8379924-8379946 CTGTTCCCATTTCACAGATGAGG - Intronic
1051951606 9:22641165-22641187 ATTGCCCCATTTCACAAATGAGG - Intergenic
1052795164 9:32916928-32916950 ATTAGCCCATTTCACAAATGAGG + Intergenic
1053304858 9:36977233-36977255 TTCCTCCCATTTTACAGATGAGG + Intronic
1053312480 9:37028246-37028268 CTCTGCCCATTTTACAGAAGAGG - Intronic
1053484445 9:38441563-38441585 ATCACCCCATTTCACAGATGAGG - Intergenic
1054906125 9:70415045-70415067 CTTCCCTCACTTCACAAATGTGG + Intergenic
1055032274 9:71782800-71782822 ATCCACACATTTTACAAATGAGG + Intronic
1055440627 9:76332661-76332683 ATCAACCCATTTTACAAATGAGG + Intronic
1055689214 9:78811340-78811362 CTACTCCCATTCCACCAATGAGG - Intergenic
1057199023 9:93130602-93130624 GTCTACCCATTTTACAAATGAGG - Intronic
1057231450 9:93324083-93324105 GTCCCCTCATTTCCCAAATGTGG + Intronic
1057236648 9:93366540-93366562 GTCCTCTCATTTCCCAAATGTGG - Intergenic
1057842697 9:98499330-98499352 CTCCCCTCATTTCACAGATGAGG + Intronic
1058721545 9:107769046-107769068 TTATGCCCATTTTACAAATGAGG + Intergenic
1059032163 9:110710306-110710328 TACCCCCCATTTCACAAATGAGG - Intronic
1059346610 9:113633178-113633200 TTACCCCCATTTCACAGATGAGG - Intergenic
1059389156 9:113988069-113988091 CTCCACCCATTTTACAGTTGGGG - Intronic
1059430318 9:114246043-114246065 CTCTACCCCTTTCACGAATGTGG + Intronic
1059758390 9:117315526-117315548 TTACTCCCATTTCATAAATGAGG - Intronic
1060025471 9:120167131-120167153 CTGTGGCCATTTCACAGATGTGG - Intergenic
1060259391 9:122060703-122060725 CTCCCCCCATTTTACAGATGAGG - Intronic
1060417422 9:123441999-123442021 ATATGCCCATTTCACAGATGAGG - Intronic
1060488093 9:124062351-124062373 CCACTCCCATTTCACAGATGGGG + Intergenic
1060591421 9:124819404-124819426 CTGCCCACATTTCACAAATGAGG + Intergenic
1060988615 9:127835704-127835726 CTACCCCCATTTCACAGATGAGG - Intronic
1060991151 9:127849871-127849893 CTGCCCCCATTTGACAGATGGGG - Intronic
1061006146 9:127929416-127929438 CTCCCCCCATTATACAGATGGGG + Intronic
1061180798 9:129023954-129023976 TTCACCCCATTTCCCAAATGAGG + Intronic
1061232694 9:129324028-129324050 CTGTCCCCATTTCACAAGTGAGG - Intergenic
1061292213 9:129657204-129657226 CTAGGCCCGTTTCACAGATGGGG - Intergenic
1061429438 9:130521922-130521944 CTGGGCCCATTTTACAGATGAGG - Intergenic
1186185550 X:7016503-7016525 CCCCACCCATTTCAATAATGGGG + Intergenic
1186869775 X:13759550-13759572 CTGCTCCCATTTTACAGATGGGG - Intronic
1187363864 X:18650855-18650877 ATGCCCCCATTTCACAGATGAGG - Intronic
1187737268 X:22317484-22317506 ATCGGCCCATTTTACATATGAGG + Intergenic
1189082820 X:37992502-37992524 CTACCCCCATTTTACACATGAGG - Intronic
1189345713 X:40239832-40239854 CTCTGCCCAGATCACAAATTTGG - Intergenic
1189569044 X:42275465-42275487 CTATTCCCATTTTACAAATGAGG - Intergenic
1191963647 X:66731219-66731241 GTTCTTCCATTTCACAAATGAGG - Intergenic
1192101975 X:68274249-68274271 TTTTCCCCATTTCACAAATGAGG - Intronic
1192261465 X:69508284-69508306 CTACTCCCATTTTACAGATGAGG + Intronic
1195432805 X:104808337-104808359 TTATGCCCATTTCATAAATGGGG + Intronic
1195564875 X:106328867-106328889 CTCCTCCCTTTTCTCAAATCAGG - Intergenic
1195966923 X:110437417-110437439 CTGTGCCCATTTTACAGATGAGG + Intronic
1196058351 X:111380934-111380956 CTTCCTCCATTTCATAAATGTGG + Intronic
1196997298 X:121397958-121397980 TTACCCCCATTTTACAAATGAGG - Intergenic
1197289234 X:124635195-124635217 CTTCCACTATTTCACAAATGAGG + Intronic
1197752359 X:129974133-129974155 TAGCCCCCATTTCACAAATGAGG + Intergenic
1198003673 X:132468638-132468660 CTGTACCCATTTCACAGATGAGG + Intronic
1198036576 X:132806970-132806992 TTGTGCCCATTTTACAAATGAGG + Intronic
1198084251 X:133267452-133267474 ATCTGCTCATTTTACAAATGAGG - Intergenic
1199267721 X:145847831-145847853 CTCCTCTCATTTTACACATGGGG - Intergenic
1199946079 X:152669296-152669318 TTCCCCCCATTGCACAGATGGGG + Intergenic
1200138971 X:153888133-153888155 GTGCCCCCATTTCACAGATGAGG + Intronic