ID: 1175888562

View in Genome Browser
Species Human (GRCh38)
Location 20:62305933-62305955
Sequence CCTCCGCCCATTTCACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888562_1175888580 18 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888580 20:62305974-62305996 GATTGCGGCGGATGGGGACAGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1175888562_1175888572 3 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888572 20:62305959-62305981 ACAGGGCACACCCGGGATTGCGG 0: 1
1: 0
2: 0
3: 12
4: 92
1175888562_1175888574 10 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888562_1175888579 17 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888579 20:62305973-62305995 GGATTGCGGCGGATGGGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1175888562_1175888571 -4 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888571 20:62305952-62305974 GAGGGGGACAGGGCACACCCGGG 0: 1
1: 0
2: 7
3: 49
4: 610
1175888562_1175888573 6 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888573 20:62305962-62305984 GGGCACACCCGGGATTGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1175888562_1175888576 12 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888576 20:62305968-62305990 ACCCGGGATTGCGGCGGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1175888562_1175888575 11 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888575 20:62305967-62305989 CACCCGGGATTGCGGCGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1175888562_1175888570 -5 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888570 20:62305951-62305973 GGAGGGGGACAGGGCACACCCGG 0: 1
1: 0
2: 5
3: 145
4: 3700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888562 Original CRISPR CCTCCGCCCATTTCACAAAT GGG (reversed) Intronic
900343073 1:2197743-2197765 CCTCCTCCCATGTCACCACTGGG + Intronic
901162666 1:7191972-7191994 CATCAGCCCATTTCCCAGATGGG - Intronic
902227824 1:15007804-15007826 CCACCGCCCATTTCACTTCTCGG + Intronic
903769070 1:25752819-25752841 ACTGTTCCCATTTCACAAATGGG - Intronic
904276610 1:29388909-29388931 CTTCCCCCCATTTTACAGATGGG - Intergenic
904290396 1:29481715-29481737 ACTCCTCCCATTTAACACATGGG - Intergenic
904933743 1:34111619-34111641 CTTCATCCCATTTAACAAATGGG + Intronic
905200681 1:36314331-36314353 CCTTTGCCCATTTAAAAAATTGG + Intronic
905474537 1:38216860-38216882 CCTTCGTTCATTTAACAAATAGG + Intergenic
907307394 1:53520899-53520921 AGTCAGCCCATTTCACAGATGGG - Intronic
908238002 1:62166000-62166022 ACTCCTCCCATTTTACAAGTGGG + Intergenic
908631129 1:66108611-66108633 CCTTTGCCCATTTAAAAAATTGG - Intronic
908679030 1:66638744-66638766 TCTCCACCCATTTGTCAAATTGG + Intronic
910937882 1:92501267-92501289 CCTTTGCCCATTTAAAAAATTGG - Intergenic
913690249 1:121272825-121272847 ATTCCTCCCATTTCACAAAGAGG - Intronic
916370681 1:164090970-164090992 CCTCTGCCCATTCCAAAAAGTGG + Intergenic
923189429 1:231606331-231606353 ATTACCCCCATTTCACAAATGGG - Intronic
924464142 1:244284969-244284991 TCTCACCCCATTTCACAGATGGG + Intergenic
1064222915 10:13456578-13456600 CCCCCGCCCATATCATACATTGG - Intronic
1065421397 10:25548551-25548573 GCTGTGCCCATTTTACAAATGGG + Intronic
1066351570 10:34641733-34641755 CATCAGCCCATTTCACGAATGGG - Intronic
1070274948 10:74997058-74997080 CCTCTGCCCATTTCTCTATTAGG - Intronic
1071288800 10:84173283-84173305 CCTGTGCCCATTTCACAGATGGG + Intergenic
1072784238 10:98269137-98269159 CCTCTGCCCATTTTACAGATGGG - Intergenic
1073091025 10:100939744-100939766 CCTCTGCCCATTTTTCTAATAGG - Intronic
1074100386 10:110349953-110349975 CCTCCTCCCACTTCACAAGCAGG - Intergenic
1074624992 10:115173220-115173242 CCTGGGCCCATTTCAAAAGTTGG - Intronic
1076229968 10:128812012-128812034 CCTCCTCTCAGTTCAGAAATGGG - Intergenic
1079474568 11:20815483-20815505 CCTTTGCCCATTTCTTAAATGGG + Intronic
1080097197 11:28423018-28423040 CTTCTGCCCATTTTAAAAATTGG - Intergenic
1081517373 11:43846336-43846358 CCTAGTCCCATTTTACAAATAGG + Intronic
1081744384 11:45462798-45462820 CCACCCCTCATTTCACAGATGGG + Intergenic
1082888950 11:58118069-58118091 CCTCTGCGAATTGCACAAATTGG - Intronic
1083756264 11:64793312-64793334 ACACGGCCCATTTCACAGATGGG + Intronic
1084033818 11:66495918-66495940 CCTACTCCCATTTCACAGAGAGG - Intronic
1084152227 11:67293817-67293839 CCTTCACCCATTTAAAAAATTGG + Intronic
1084504190 11:69554812-69554834 CCTCTGCCAATTTCAAAATTAGG - Intergenic
1084581217 11:70024616-70024638 CCTCTCCCCAGTTCACAGATGGG + Intergenic
1084736027 11:71106152-71106174 GCTCTGCTCATTTCACAAAAGGG + Intronic
1085053393 11:73391021-73391043 CCCCATCCCATTTCACAGATGGG - Intronic
1085519322 11:77128894-77128916 CATACTCCCATTTCACAGATGGG - Intronic
1089669279 11:120041690-120041712 CCTTCGCCCATTTTAAAATTGGG - Intergenic
1090253160 11:125264868-125264890 AGTCCTCCCATTTCACAGATGGG - Intronic
1090958294 11:131533626-131533648 CCTGCCCCCATTTCACAGAAGGG - Intronic
1092765034 12:11845158-11845180 CCCACCTCCATTTCACAAATGGG - Intronic
1093123667 12:15302860-15302882 CCTTTGCCCATTTTAAAAATCGG - Intronic
1095823031 12:46500257-46500279 CCTCAGCCCATTTAAAAAATTGG + Intergenic
1097701900 12:62828772-62828794 CCTTTGCCCATTTTAAAAATTGG - Intronic
1100160288 12:91852148-91852170 CCTTTGCCCATTTAAAAAATGGG - Intergenic
1101854518 12:108431108-108431130 TCTGTGCCCATTTCACAGATGGG - Intergenic
1102205684 12:111089326-111089348 ACTCCCCCCATTTCTCAGATGGG - Intronic
1104710827 12:130984712-130984734 CTTTCGCCCATTTTAAAAATTGG + Intronic
1105499238 13:20957095-20957117 CCTTTGCCCATTTAAAAAATTGG - Intergenic
1105838909 13:24236298-24236320 CCTCTGCCCATTTTTTAAATGGG - Intronic
1106694158 13:32152924-32152946 CTTCTGCCCATTTAAAAAATTGG - Intronic
1108155020 13:47575956-47575978 CCACTGTGCATTTCACAAATTGG + Intergenic
1114656258 14:24317354-24317376 CTTCCCTCCATTTCACAAAGAGG + Exonic
1116419106 14:44712749-44712771 CAGCCAACCATTTCACAAATGGG + Intergenic
1122338005 14:101006515-101006537 CCTCTTCCCATTTCACAGATGGG - Intergenic
1122411662 14:101528867-101528889 CCTCAGCCCACTGCACAGATGGG + Intergenic
1122435248 14:101690914-101690936 GCTACGGACATTTCACAAATGGG - Intergenic
1123791570 15:23726133-23726155 CCTTCGCCCTTTTAAAAAATTGG + Intergenic
1124176528 15:27430224-27430246 CCTCTGCCCATTTTTCAATTGGG + Intronic
1125326708 15:38542563-38542585 CCTCTTCCAATTTCAGAAATCGG + Intronic
1126837927 15:52686508-52686530 CCTAACCCCTTTTCACAAATGGG + Intronic
1129773532 15:78218131-78218153 CCTTTCCCCATTTTACAAATGGG - Intronic
1130293884 15:82629196-82629218 CCTTTTTCCATTTCACAAATGGG - Intronic
1132555195 16:569228-569250 TCTCCTCCCATTTTACAAGTGGG + Exonic
1133932242 16:10241981-10242003 CATCCCCCCATTTTACAGATAGG - Intergenic
1135705550 16:24671599-24671621 ACTGCGCCCATTTCACAGATGGG + Intergenic
1135844421 16:25905716-25905738 CCTTCCCCCATTTCTCAAAAAGG - Intronic
1135966163 16:27036961-27036983 ATTCCCTCCATTTCACAAATGGG - Intergenic
1136339808 16:29635057-29635079 CCTCCGGACATTTTATAAATAGG - Intergenic
1138535616 16:57658784-57658806 CATCCTCCCACTTCACAGATAGG + Intronic
1138826371 16:60325399-60325421 CCTCCTTCCATTTTACAGATAGG - Intergenic
1139759924 16:69176688-69176710 CTTCTGCCCCTTACACAAATGGG - Intronic
1139957592 16:70700500-70700522 CTTCCCCCTATTTCACAGATAGG - Intronic
1140324967 16:73992658-73992680 CCCCTGCCCATTTTAAAAATTGG - Intergenic
1141284948 16:82662926-82662948 CCTTCTCCCATATGACAAATCGG + Intronic
1141672949 16:85502418-85502440 ACTCCTCCCATTTTACCAATGGG + Intergenic
1142042479 16:87903614-87903636 CCTCCGGACATTTTATAAATAGG - Intronic
1142689501 17:1596762-1596784 CCTTTGCCCATTTAAAAAATTGG - Intronic
1144517884 17:15931702-15931724 CCTTTGCCCATTTTAAAAATTGG + Intergenic
1144582206 17:16465363-16465385 CATCTGCCCATTTCACAGATAGG - Intronic
1144764912 17:17727412-17727434 ACCCTGCCCATTTCACAGATGGG + Intronic
1146943153 17:36857793-36857815 ACTACCCCCATTTCACAGATGGG - Intergenic
1147460792 17:40567173-40567195 CCTTTGCCCATTTAAAAAATTGG + Intergenic
1148219172 17:45850074-45850096 ACTCTGCCCATTTCACAGATGGG + Intergenic
1152050747 17:77974223-77974245 CCTTCGCCCATTTTAAAATTGGG - Intergenic
1152073764 17:78146667-78146689 CATCCGCCCATTTCGCAGATGGG - Intronic
1152459687 17:80435066-80435088 CCTTTGCCCATTTTAAAAATTGG + Intronic
1155646853 18:28088815-28088837 CCTCCACTCATTTCACACTTTGG - Intronic
1158427581 18:57353273-57353295 CCTTCCCTCATTTCAGAAATGGG + Intronic
1158809456 18:61015297-61015319 CCTCTGCCCATTTCTTAATTTGG + Intergenic
1159135570 18:64332989-64333011 CCTCCGGGCATTTAACAAAGTGG - Intergenic
1159324674 18:66899441-66899463 ACTCTGCCCATTTCATAATTGGG + Intergenic
1161398686 19:4058360-4058382 CCTCTGCCCATTTGACAGATAGG - Intronic
1162530062 19:11230807-11230829 CCTATACCCATTTCACAGATGGG - Intronic
1162662071 19:12177802-12177824 CCTTTGCCCATTTGAAAAATTGG + Intronic
1163453841 19:17394379-17394401 ACTCTCCCCATTTCACAAAGGGG - Intergenic
1164582305 19:29442167-29442189 CTTGCCCCCATTTCACAGATGGG - Intergenic
1166647252 19:44541285-44541307 TCTCCCCCCATTTTACAGATTGG + Intergenic
1166855522 19:45781084-45781106 CCTCCTCCCATTTCACAGATGGG - Intronic
1167449268 19:49557299-49557321 CTTCCTCCCATTTCACAGGTAGG + Intronic
1167507539 19:49878725-49878747 CCTCTGCCCATTTCACAGAGAGG - Intronic
925233881 2:2260244-2260266 CCAATGCCCATTTCACAGATGGG - Intronic
926566014 2:14474979-14475001 CCTCTGCCCATTTCTAAAAAGGG - Intergenic
927001450 2:18798735-18798757 CCTCCTCTCATTTCATGAATGGG - Intergenic
927892914 2:26763732-26763754 CATCCGCCCCTTTTACAAATAGG + Intergenic
931478227 2:62611830-62611852 CCACCTCCCTTTACACAAATCGG + Intergenic
937030643 2:118736685-118736707 CCTCTGCCCATTTTTCTAATTGG + Intergenic
945112395 2:206373076-206373098 CCTTTGCCCATTTCAAAATTGGG + Intergenic
946595390 2:221300673-221300695 CCTGCACCCAACTCACAAATCGG - Intergenic
947262658 2:228241255-228241277 ACTTCGCCCATTTTAAAAATTGG + Intergenic
948465221 2:238148872-238148894 CCTACTCCCATTTCACAGACAGG + Intronic
1168955798 20:1833320-1833342 CCACCTCCCACTTCACAGATAGG + Intergenic
1172030643 20:31979876-31979898 TCTGCACCCATTTCACAGATGGG + Intronic
1172049847 20:32109167-32109189 CCCCTTCCCATTTCACAGATGGG + Intergenic
1172884237 20:38220784-38220806 CCTGCCTCCATTTCACAGATGGG + Intronic
1173312909 20:41916485-41916507 TCTCTCCCCATTTCCCAAATTGG - Intergenic
1173772677 20:45676573-45676595 CCTCTGCCCATTTTTTAAATAGG + Intergenic
1173868455 20:46327738-46327760 CCTGCACCCATTTCACCGATGGG - Intergenic
1174298705 20:49567539-49567561 CCTCAACCCATTACACAGATGGG - Intronic
1175068739 20:56313512-56313534 CCTTTGCCCATTTTAAAAATTGG - Intergenic
1175220702 20:57414905-57414927 ACTGTGCCCATTTCACAGATGGG + Intergenic
1175258038 20:57658621-57658643 TGTCAGCCCATTTTACAAATGGG + Intronic
1175888562 20:62305933-62305955 CCTCCGCCCATTTCACAAATGGG - Intronic
1179816304 21:43908505-43908527 CCTGTGCCCATTTCACAGACAGG - Intronic
1181949778 22:26545541-26545563 CCTTCCCCCATTTTACAGATGGG + Intronic
1181971861 22:26696988-26697010 CCTCCGCCCATTAAAAAAATGGG + Intergenic
1183396199 22:37572192-37572214 ACTCTGCCCATTTCATAGATGGG - Intronic
1183425997 22:37739701-37739723 TCCCCGCCCATTCCACAGATGGG - Intronic
1183666938 22:39251578-39251600 GCCACCCCCATTTCACAAATGGG + Intergenic
1184246642 22:43239135-43239157 CATTCCCCCATTTCACAGATGGG - Intronic
1184279725 22:43430071-43430093 CTTCCTCTCATTTTACAAATGGG - Intronic
1184831417 22:46991142-46991164 CCTCTCTCCATTTCACAGATGGG + Intronic
949183667 3:1165325-1165347 CTTCCTCCCATTACACCAATAGG + Intronic
950106754 3:10393467-10393489 CCTCACCCCATTTCACAGATAGG + Intronic
950873457 3:16249232-16249254 ACTCTCCCCATTTCACAGATGGG + Intergenic
950895233 3:16443399-16443421 CCTCTGCCCATTTTTCAAGTTGG + Intronic
953890107 3:46744902-46744924 CCTCTTCCCATTTCAGAGATGGG + Intronic
954433949 3:50486068-50486090 CCCGGGCCCATTTCACAAACGGG + Intronic
955518980 3:59755975-59755997 CCTACTCCCATTTTACAAAGGGG - Intronic
956105035 3:65808714-65808736 TCTCCACCCACCTCACAAATTGG + Intronic
956603802 3:71051406-71051428 CCTCCTCCCTTGACACAAATTGG - Intronic
956833649 3:73077628-73077650 CCTTTGCCCATTTTCCAAATTGG + Intergenic
957225838 3:77444879-77444901 CCTCCGCACATTCCAAACATAGG - Intronic
957443277 3:80280984-80281006 CCTCTGCCCATTTTTTAAATTGG + Intergenic
958619377 3:96536773-96536795 CGTCTGCCCATTTAAAAAATTGG - Intergenic
960072119 3:113442195-113442217 CCTTTGCCCATTTAAGAAATTGG - Intergenic
965789539 3:172372891-172372913 GCTGTGCCCATTTTACAAATGGG + Intronic
967419770 3:189260138-189260160 CCTCCCTCCAGTTTACAAATGGG - Intronic
968958874 4:3732673-3732695 GTTCCTCCCATTTCACAGATCGG - Intergenic
979192095 4:117874301-117874323 CCTCCTCCCATTTGAAAAGTTGG + Intergenic
981139623 4:141253554-141253576 CCTCAGCACATTTCACCAAGAGG - Intergenic
983580067 4:169300644-169300666 CCTTTGCCCATTTAAAAAATTGG - Intergenic
987022006 5:13884095-13884117 CCTCGGCACAGTTCAGAAATAGG - Intronic
988155225 5:27441287-27441309 GCTCCCCTCATTTCCCAAATAGG + Intergenic
989277440 5:39605960-39605982 CTTCTGCCCATTTCATAATTGGG + Intergenic
989573064 5:42963157-42963179 CCTCTGCCCATTTTTGAAATGGG - Intergenic
994003063 5:94804341-94804363 CACCAGCCCATTTCACAAGTTGG + Intronic
996857337 5:128023653-128023675 CCTCTCCTCATTTTACAAATAGG - Intergenic
997620104 5:135282746-135282768 CCTCTGCCCATTTTAAAAATGGG + Intronic
998132569 5:139658766-139658788 CCTCTCCCCATTGCACAGATGGG - Intronic
998872361 5:146565314-146565336 CCTCCGCCCCTGTCAGAGATTGG + Intergenic
999065984 5:148686070-148686092 CATTCACTCATTTCACAAATGGG - Intergenic
1000981568 5:167822144-167822166 CCCAAGCCCATTTCACAGATGGG - Intronic
1001532639 5:172474964-172474986 ATTCCTCCCATTTCACAGATGGG + Intergenic
1002057518 5:176607091-176607113 CCCTCTCCCATTTCACAGATTGG - Intronic
1002209998 5:177592815-177592837 AATCCGCCCATTTCACAGACCGG - Intronic
1003768552 6:9269797-9269819 GTTCCGACAATTTCACAAATAGG + Intergenic
1005454017 6:26001410-26001432 CCTCTCCCCATTTCCCACATTGG + Intergenic
1006014465 6:31068713-31068735 CCTCAGCTCACTTCACAAATTGG - Intergenic
1008067098 6:47061556-47061578 CCTCCGCCCATTCCAGAATCTGG + Intergenic
1011672351 6:89695347-89695369 CCTCTGCCCATTGCACCTATTGG + Intronic
1014869010 6:126568215-126568237 CCTTTGCCCATTTTAAAAATTGG - Intergenic
1016271644 6:142297082-142297104 CCTTCTCCCATATCACAAAGAGG - Intergenic
1017881298 6:158564378-158564400 CATCGGCCCATTTCACAGGTGGG - Intronic
1018150739 6:160935177-160935199 CCTTTGCCCATTTAAAAAATTGG + Intergenic
1018442679 6:163827535-163827557 CCTCCTTCCCCTTCACAAATGGG - Intergenic
1019511342 7:1419119-1419141 CGTTCTCCCATTTCACAGATGGG + Intergenic
1020130349 7:5555800-5555822 CCTCCCCCCATTTAACAGACAGG - Intronic
1023639333 7:42241738-42241760 CCTCCGCCAATCCCACAAGTTGG + Intergenic
1025996712 7:66531806-66531828 CCTCTTCCTATTTCACAAGTAGG - Intergenic
1028546666 7:92009513-92009535 ACTGAGACCATTTCACAAATGGG + Intronic
1030146306 7:106359613-106359635 ACTACTCCCATTTTACAAATGGG - Intergenic
1031962979 7:128006402-128006424 CCTCCCCCCACCTCCCAAATAGG + Intronic
1039441888 8:37600789-37600811 AATCCACCCATTTCACAGATTGG + Intergenic
1040892110 8:52327990-52328012 CCTCCTCCCATTTTCCAGATGGG - Intronic
1044383049 8:91556133-91556155 CCTGTACCAATTTCACAAATAGG + Intergenic
1044588200 8:93887799-93887821 CCTTTGCCCATTTTAGAAATTGG - Intronic
1046897653 8:119489849-119489871 CCTCCTCCCCTTAGACAAATAGG - Intergenic
1047501320 8:125443969-125443991 ACTCCTCCCATTTTACAGATGGG + Intergenic
1051729810 9:20129106-20129128 CCTTTGCCCATTTCAAAAGTGGG - Intergenic
1052298469 9:26926317-26926339 CCTCCCTCCATCTCACAAATGGG + Intronic
1052944589 9:34157880-34157902 CCTCTGCCCATTTTACCACTGGG - Intergenic
1054879179 9:70127032-70127054 CCTCAGCCAACTTCACAAAGGGG + Intronic
1055221172 9:73933892-73933914 CCTTTGCCCATTTTAAAAATTGG - Intergenic
1057186235 9:93058865-93058887 TCTGCGCCCATTTCACAGACGGG + Intronic
1059531501 9:115039630-115039652 CCTCAGCTCATTTCACAGAGAGG + Intronic
1060290179 9:122295249-122295271 CATCATCCCCTTTCACAAATAGG + Intronic
1060966151 9:127713326-127713348 CTTCAGCCCATTTTACAGATGGG - Intronic
1190058712 X:47197290-47197312 CCTATGCCCAAATCACAAATGGG - Intronic
1190889800 X:54558229-54558251 CCACCCCCCATTTGACAGATAGG + Intronic
1196586448 X:117434620-117434642 GCTCCACCCATTCCACAACTAGG - Intergenic
1197950660 X:131892509-131892531 CCTTTGCCCATTTTAAAAATTGG - Intergenic
1199946078 X:152669295-152669317 CTTCCCCCCATTGCACAGATGGG + Intergenic
1202020110 Y:20455499-20455521 CCTCCCCCCATTTTAGAAAGAGG - Intergenic