ID: 1175888564

View in Genome Browser
Species Human (GRCh38)
Location 20:62305934-62305956
Sequence CCCTCCGCCCATTTCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 315}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888564_1175888573 5 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888573 20:62305962-62305984 GGGCACACCCGGGATTGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
1175888564_1175888576 11 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888576 20:62305968-62305990 ACCCGGGATTGCGGCGGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1175888564_1175888571 -5 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888571 20:62305952-62305974 GAGGGGGACAGGGCACACCCGGG 0: 1
1: 0
2: 7
3: 49
4: 610
1175888564_1175888572 2 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888572 20:62305959-62305981 ACAGGGCACACCCGGGATTGCGG 0: 1
1: 0
2: 0
3: 12
4: 92
1175888564_1175888570 -6 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888570 20:62305951-62305973 GGAGGGGGACAGGGCACACCCGG 0: 1
1: 0
2: 5
3: 145
4: 3700
1175888564_1175888580 17 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888580 20:62305974-62305996 GATTGCGGCGGATGGGGACAGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1175888564_1175888575 10 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888575 20:62305967-62305989 CACCCGGGATTGCGGCGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1175888564_1175888579 16 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888579 20:62305973-62305995 GGATTGCGGCGGATGGGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1175888564_1175888574 9 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888564 Original CRISPR CCCTCCGCCCATTTCACAAA TGG (reversed) Intronic
900343071 1:2197742-2197764 CCCTCCTCCCATGTCACCACTGG + Intronic
900505385 1:3027742-3027764 CCCTCAGCCCAGATCACAGAGGG - Intergenic
901164974 1:7213756-7213778 CCCTCCGCCCACCCCACAACAGG + Intronic
903769071 1:25752820-25752842 CACTGTTCCCATTTCACAAATGG - Intronic
907065183 1:51474829-51474851 CCCTCCCCCCAACCCACAAAAGG + Intronic
907307395 1:53520900-53520922 CAGTCAGCCCATTTCACAGATGG - Intronic
907413633 1:54299384-54299406 CCCTCTGCCATTTTCACTAAAGG + Intronic
908238001 1:62165999-62166021 CACTCCTCCCATTTTACAAGTGG + Intergenic
910829884 1:91449777-91449799 CCCTCTGCCTATTTCACCAGTGG + Intergenic
910975027 1:92897499-92897521 CCCTCCGCCCACCCCACAACAGG - Intronic
913007863 1:114652410-114652432 CCCACCCCCCATTTGAGAAAAGG - Intronic
913033680 1:114938391-114938413 CCCTCCCCCCATCCCACAACAGG - Intronic
916575357 1:166062175-166062197 CCTTCTTCCCATTTCACAGATGG + Intronic
917010917 1:170469863-170469885 CCCTCCCCCCACTCCACAACAGG - Intergenic
917111245 1:171550615-171550637 CCCTCCCCCCATCCCACAACAGG + Intronic
918738050 1:188091913-188091935 CCCTCCCCCCACCTCACAACAGG - Intergenic
918791733 1:188838807-188838829 CCCTCCTCCCACCTCACAACAGG - Intergenic
919952907 1:202382266-202382288 CCCTCCCCCCACTCCACAACAGG - Intronic
920483333 1:206344795-206344817 CCCTATGCACATTTCACCAAAGG + Intronic
920512320 1:206560351-206560373 CCCTCCGACCTCTTCCCAAAGGG - Intronic
920955275 1:210614559-210614581 CCCTCCCCCCACCTCACAACAGG + Intronic
921954663 1:220969666-220969688 CCCTCTGACCATTTCAAAGAAGG + Intergenic
1064701436 10:18025381-18025403 CCCTCCCCCCACCTCACAACAGG + Intronic
1064947871 10:20812468-20812490 CCCTCCCCCCACCTCACAACAGG + Intronic
1065104090 10:22362800-22362822 CCCTGTGCCCAATTCAAAAATGG + Intronic
1065152884 10:22840338-22840360 CACTCTGCCCATTTCAAAAGTGG - Intergenic
1065593824 10:27293316-27293338 CCCTTCTCGTATTTCACAAAGGG - Intergenic
1065656523 10:27956944-27956966 CCCTTCTCCTGTTTCACAAAAGG + Intronic
1066172687 10:32868716-32868738 CCCTCCCCCCACCCCACAAAAGG + Intronic
1066351571 10:34641734-34641756 TCATCAGCCCATTTCACGAATGG - Intronic
1069337587 10:67371377-67371399 CCCTCCCCCCATCCCACAACAGG + Intronic
1070615745 10:77968015-77968037 TCCTCCCACCACTTCACAAAAGG - Intergenic
1070653203 10:78252886-78252908 GCATCTGCCCATTTCACAGATGG - Intergenic
1070921801 10:80191885-80191907 ACCTCACCCCATTTCACAAATGG + Intronic
1071047439 10:81399229-81399251 CCCTTCTCCCATTTCTCAAGAGG - Intergenic
1071288798 10:84173282-84173304 TCCTGTGCCCATTTCACAGATGG + Intergenic
1071954283 10:90741019-90741041 CCCTCCTCCCCTTTCAGGAAAGG + Exonic
1072394468 10:95024676-95024698 CCCTCCCCCCACTCCACAACAGG - Intergenic
1072491061 10:95906457-95906479 CCCTCCCCCCATTCCACAACAGG - Intronic
1072784240 10:98269138-98269160 CCCTCTGCCCATTTTACAGATGG - Intergenic
1076470243 10:130713695-130713717 CCCTCCCCTCCTTACACAAACGG - Intergenic
1078183674 11:9033066-9033088 CCCTTCTCCCATTTAATAAAAGG + Intronic
1081590634 11:44420561-44420583 CCCTCTCCCCATTTTAGAAAAGG - Intergenic
1081671094 11:44943118-44943140 CACTACCCCCATTTCACAAGAGG - Intronic
1081744382 11:45462797-45462819 CCCACCCCTCATTTCACAGATGG + Intergenic
1082090076 11:48081750-48081772 CCCCCCACCCATTTTACAGATGG - Intronic
1083343210 11:61972184-61972206 CCCTCCCCCCATTTCCTAATGGG + Intergenic
1083756263 11:64793311-64793333 CACACGGCCCATTTCACAGATGG + Intronic
1084581215 11:70024615-70024637 CCCTCTCCCCAGTTCACAGATGG + Intergenic
1084736026 11:71106151-71106173 AGCTCTGCTCATTTCACAAAAGG + Intronic
1084944647 11:72632103-72632125 CCCTCCCCCCAGCTCACAGAAGG - Intronic
1085170312 11:74444194-74444216 CCCGCCGCCCATTTCATACTAGG + Intergenic
1085848504 11:80093898-80093920 CCCTCCCCCCATCCCACAACAGG - Intergenic
1087341584 11:96913897-96913919 CCCTCCCCCCACCTCACAACAGG - Intergenic
1089634940 11:119806065-119806087 GCATCCCCCCATTTCACAGATGG + Intergenic
1090253161 11:125264869-125264891 CAGTCCTCCCATTTCACAGATGG - Intronic
1090958296 11:131533627-131533649 TCCTGCCCCCATTTCACAGAAGG - Intronic
1091133176 11:133164038-133164060 CATTCTGCCTATTTCACAAAGGG + Intronic
1091350257 11:134888262-134888284 CCCTCCCCACATTTCTCTAAAGG - Intergenic
1092325000 12:7521695-7521717 CCCTCCCCCCATCCCACAACAGG + Intergenic
1092594782 12:9989206-9989228 CCCTCCCCCCATCCCACAACAGG - Intronic
1093307305 12:17537044-17537066 CCCGCCGCCCCATTTACAAAAGG + Intergenic
1094334167 12:29328735-29328757 CCCTCCCCCCACTCCACAACAGG - Intronic
1095576948 12:43751345-43751367 CCCTCCCCCCACTCCACAACAGG + Intronic
1096785035 12:54012036-54012058 CCCTCCCCCCATTTCCAGAAGGG + Exonic
1097058043 12:56262124-56262146 GCCTCCTTCCAGTTCACAAATGG - Intergenic
1098637957 12:72807727-72807749 CCCTCCCCCCATCCCACAACAGG + Intergenic
1100063096 12:90605690-90605712 CCCTCCCCCCATCCCACAACAGG + Intergenic
1101048511 12:100836489-100836511 CCCTCCCCCCATCCCACAACAGG + Intronic
1101702794 12:107191034-107191056 CCCTCCTCCCACTCCACAACAGG - Intergenic
1101854519 12:108431109-108431131 CTCTGTGCCCATTTCACAGATGG - Intergenic
1104370032 12:128216257-128216279 CACTATGCCCATTTCACAGAGGG - Intergenic
1105993159 13:25643056-25643078 CCCTCCCCCCATCCCACAACAGG - Intronic
1106745541 13:32701981-32702003 CTCTTCCCACATTTCACAAAAGG - Intronic
1108445323 13:50503186-50503208 CCCTCCCCCCACTCCACAACAGG + Intronic
1109100892 13:58182292-58182314 CCCTCCGCCCACCCCACAACAGG + Intergenic
1109126530 13:58525380-58525402 CCCTCCGCCCACCCCACAACAGG - Intergenic
1109381551 13:61568129-61568151 CCCTCCTCCCAACTCACAACAGG + Intergenic
1109565791 13:64115040-64115062 CCCTGCCCCCATTCCACAACAGG + Intergenic
1110027243 13:70556200-70556222 CCCTCCCCCCACCTCACAACAGG + Intergenic
1110745939 13:79053588-79053610 CCCTTCACCCATCTCCCAAAAGG + Intergenic
1112663254 13:101539200-101539222 CCCTCCCCCCACTCCACAACAGG + Intronic
1113268755 13:108649067-108649089 CCCTCCCCCCATCCCACAACAGG - Intronic
1113695732 13:112343900-112343922 GCCTCCGCCCGTTTCTCAGATGG + Intergenic
1114140504 14:19904250-19904272 CCCTCCCCCCACCTCACAACAGG - Intergenic
1114168696 14:20249002-20249024 CCCTCCCCCCATCCCACAACAGG + Intergenic
1115416270 14:33138202-33138224 CCCTCCCCCCACCTCACAACAGG + Intronic
1115969306 14:38927667-38927689 CCCTCCGCCCACCCCACAACAGG - Intergenic
1117446547 14:55808698-55808720 CCCTCCCCCCACTCCACAACAGG + Intergenic
1121241758 14:92435847-92435869 CACTCCTCCCCTTTCACTAAGGG + Intronic
1122338007 14:101006516-101006538 CCCTCTTCCCATTTCACAGATGG - Intergenic
1122822342 14:104353858-104353880 CCCTCTGCCCATTTGACAGATGG - Intergenic
1123180239 14:106462823-106462845 CCCTCCCCCCACCTCACAACAGG - Intergenic
1123197850 14:106633662-106633684 CCTTCCGCCAATTTCACAATTGG + Intergenic
1124561807 15:30781238-30781260 CCCTCCCCCCATCCCACAACAGG - Intergenic
1125753204 15:42044627-42044649 CCCTCCCCCCATCCCACAACAGG - Intronic
1126016275 15:44354292-44354314 CCCTCCCCCCACTACACAACAGG - Intronic
1126722558 15:51596914-51596936 CCCTCCTCCCACCTCACAACAGG - Intronic
1126837925 15:52686507-52686529 CCCTAACCCCTTTTCACAAATGG + Intronic
1126889505 15:53189055-53189077 CCCTCCCCCCACCCCACAAAAGG - Intergenic
1129773534 15:78218132-78218154 CCCTTTCCCCATTTTACAAATGG - Intronic
1132555194 16:569227-569249 CTCTCCTCCCATTTTACAAGTGG + Exonic
1133464157 16:6013955-6013977 CCCTCCCCCCATCCCACAACAGG - Intergenic
1134652137 16:15917920-15917942 CAATCTGCCCATTTGACAAAGGG + Intergenic
1135705549 16:24671598-24671620 CACTGCGCCCATTTCACAGATGG + Intergenic
1135966164 16:27036962-27036984 CATTCCCTCCATTTCACAAATGG - Intergenic
1138451173 16:57093993-57094015 ACATCAGCCCATTTCACAGATGG - Intronic
1143312580 17:6004357-6004379 CCCTCCCCCCATCCCACAACAGG - Intronic
1143768761 17:9154513-9154535 GCCTCGGCCCCTTTCCCAAAAGG + Intronic
1144321296 17:14122916-14122938 GCATCCGCCCACTTCAGAAATGG + Intronic
1144326766 17:14190037-14190059 CCTTCCTCCCATTTCAGAAGAGG - Intronic
1144475647 17:15586901-15586923 CCTTCCTCCCATTTCAGAAGAGG - Intronic
1145281579 17:21471397-21471419 CCCTTCTCCCACATCACAAAAGG + Intergenic
1145395853 17:22494224-22494246 CCCTTCTCCCACTTCACAAGAGG - Intergenic
1145812456 17:27772642-27772664 CTCTCCTCCCTTTTCCCAAAGGG - Intronic
1146943154 17:36857794-36857816 CACTACCCCCATTTCACAGATGG - Intergenic
1147702765 17:42406193-42406215 CGCTCCGCCCATTTCCAAAGTGG - Intronic
1147820949 17:43241592-43241614 GCCCCCGCCCCTTTCACAGAGGG + Intergenic
1148219171 17:45850073-45850095 AACTCTGCCCATTTCACAGATGG + Intergenic
1150890258 17:69139940-69139962 CCCTCCCCCCATCCCACAACAGG - Intronic
1151388832 17:73772018-73772040 CCCTCCACCCATCACTCAAAAGG - Intergenic
1152073765 17:78146668-78146690 TCATCCGCCCATTTCGCAGATGG - Intronic
1153850930 18:9093472-9093494 CCCTCCCCCCATCTCACAACAGG - Intergenic
1156559805 18:38110963-38110985 CCCTCCCCCCACTCCACAACAGG + Intergenic
1156930570 18:42637618-42637640 CCCTCCCCCCACTCCACAACAGG - Intergenic
1158052396 18:53239037-53239059 CCCTCCCCCCACTCCACAACAGG - Intronic
1158427579 18:57353272-57353294 CCCTTCCCTCATTTCAGAAATGG + Intronic
1158500875 18:58000383-58000405 CCCTCTGACCACTTGACAAATGG - Intergenic
1159626701 18:70703541-70703563 CCCTCCCCCCACCTCACAACAGG + Intergenic
1160351967 18:78190270-78190292 CCCTCCCCCCACTCCACAACAGG - Intergenic
1162939096 19:13997381-13997403 CCGTCCTCCCATTTCACAGATGG - Intronic
1163453842 19:17394380-17394402 TACTCTCCCCATTTCACAAAGGG - Intergenic
1166437014 19:42776194-42776216 GCCTCCCCACCTTTCACAAAAGG - Intronic
1166855524 19:45781085-45781107 TCCTCCTCCCATTTCACAGATGG - Intronic
1167511368 19:49896943-49896965 CCCTCGGCCAGTTTCCCAAAAGG - Intronic
1168302582 19:55414665-55414687 CCCTCCACCCCTTTCCCAGACGG - Intergenic
925334853 2:3088357-3088379 CCCTCCCCCCACCTCACAACAGG - Intergenic
925477898 2:4239094-4239116 CCCTCCCCCCACTCCACAACAGG - Intergenic
926078680 2:9965415-9965437 AACTCCTCCCATTTCTCAAATGG - Intronic
926566016 2:14474980-14475002 TCCTCTGCCCATTTCTAAAAAGG - Intergenic
927001452 2:18798736-18798758 CCCTCCTCTCATTTCATGAATGG - Intergenic
927711544 2:25329157-25329179 CCCTCGGCCCCCTCCACAAATGG - Intronic
927982277 2:27381452-27381474 CACTCCGCCCATTCCAAAGAGGG - Exonic
928820829 2:35358652-35358674 CCCTCCCCCCACTCCACAACAGG + Intergenic
929381808 2:41362619-41362641 CCCTCCCCCCATCCCACAACAGG - Intergenic
929574710 2:43044239-43044261 CCCTCCTGCCCTGTCACAAAGGG - Intergenic
930850509 2:55955739-55955761 CCCTCCCCCCATTCCACAACAGG + Intergenic
932061923 2:68510061-68510083 CCCTCCCCCCACTCCACAACAGG - Intronic
932282229 2:70503417-70503439 CCCTCCCCCCACCTCACAACAGG - Intronic
933126860 2:78619835-78619857 CCCTCCCCCCAGCCCACAAAAGG + Intergenic
933231314 2:79810675-79810697 CCCTCCCCCCACTCCACAACAGG + Intronic
936751201 2:115644310-115644332 CCCTCCGCCCACTCCGCAACAGG + Intronic
937732523 2:125251026-125251048 CCCTCCCCCCATCCCACAACAGG + Intergenic
939973434 2:148688405-148688427 CCCTCCCCCCATCCCACAACAGG - Intronic
940818766 2:158328161-158328183 CCCTCCGCCCACCCCACAACAGG + Intronic
941528616 2:166636937-166636959 CCCTGCGCCCATGTGACACATGG + Intergenic
943083293 2:183282471-183282493 CACTCCCCCCATTCCACAACAGG + Intergenic
943979853 2:194535065-194535087 CCCTCCCCCCATCCCACAACAGG - Intergenic
946578246 2:221099974-221099996 CCCTCCCCCCATCCCACAACAGG + Intergenic
946882235 2:224188005-224188027 CCCGCCTCCAAATTCACAAATGG - Intergenic
947074594 2:226328603-226328625 CCCTCCCCCCACTCCACAACAGG - Intergenic
947141948 2:227027470-227027492 CCCTCCTCCCACTCCACAACAGG - Intronic
947258986 2:228199284-228199306 CCCTCCCCCCACTCCACAACAGG + Intergenic
947604560 2:231476924-231476946 CCCTTTGCCCATTTTACAATTGG - Intronic
948063273 2:235057637-235057659 CCCTCCCCCCACTCCACAACAGG + Intergenic
948070541 2:235118817-235118839 CCCTCCCCCCACTCCACAACAGG + Intergenic
948917280 2:241040695-241040717 CCCTCCTGGCATTTCACAGATGG - Intronic
1169577394 20:6980436-6980458 CCCTCCGCCCACCCCACAACAGG + Intergenic
1172030642 20:31979875-31979897 CTCTGCACCCATTTCACAGATGG + Intronic
1172047400 20:32090233-32090255 CACTCTGCCCGTTTCACAGAGGG + Intronic
1172049845 20:32109166-32109188 CCCCCTTCCCATTTCACAGATGG + Intergenic
1172503938 20:35447201-35447223 CCCTCCCCCCACCTCACAACAGG + Intronic
1172884235 20:38220783-38220805 CCCTGCCTCCATTTCACAGATGG + Intronic
1172961767 20:38805390-38805412 CCCTGCTCCCATTTGACAGACGG - Intergenic
1173502803 20:43566079-43566101 CCCATCCCCCATTTCACAGATGG - Exonic
1174965644 20:55211508-55211530 AACCCAGCCCATTTCACAAAAGG - Intergenic
1175258037 20:57658620-57658642 CTGTCAGCCCATTTTACAAATGG + Intronic
1175723449 20:61301125-61301147 CCCTCAGCCCGCTTCACAGATGG + Intronic
1175888564 20:62305934-62305956 CCCTCCGCCCATTTCACAAATGG - Intronic
1178146774 21:29749430-29749452 CCTTCAGCCCATTTCACAGATGG - Intronic
1178165540 21:29971682-29971704 CCCTCAGCCCATTTTTTAAAAGG - Intergenic
1178243641 21:30931108-30931130 CCCTCCCCCCATCCCACAACAGG - Intergenic
1178497057 21:33095863-33095885 CCCTCTGTCCAATTCACAAGGGG - Intergenic
1178526692 21:33336071-33336093 CCCTCCCCCCATCCCACAACAGG + Intronic
1178968156 21:37144086-37144108 CCCTCCCCCCACCTCACAACAGG - Intronic
1179327670 21:40364521-40364543 CCCTCCCCCCATCCCACAACAGG - Intronic
1181960604 22:26619350-26619372 CAATCCTCCCATTTCACAAATGG + Intergenic
1181971859 22:26696987-26697009 TCCTCCGCCCATTAAAAAAATGG + Intergenic
1182287949 22:29259158-29259180 GCCTCCCCCCACTTCACAGAGGG - Exonic
1182715135 22:32352261-32352283 CCCTCCCCCCATCCCACAACAGG - Intergenic
1182993849 22:34794677-34794699 CACTCCCCCCATCTCACAACAGG - Intergenic
1183396200 22:37572193-37572215 CACTCTGCCCATTTCATAGATGG - Intronic
1183707645 22:39484304-39484326 CTCTGTGCCCATTTCACAGATGG + Intronic
1184279726 22:43430072-43430094 CCTTCCTCTCATTTTACAAATGG - Intronic
1184606611 22:45578062-45578084 CACTCCTCCCAGTTCACAATGGG - Intronic
1185172931 22:49304105-49304127 CCCTCAGCCCACTTCACCTAGGG - Intergenic
949268950 3:2191877-2191899 CCCTCCCCCCACTCCACAACAGG + Intronic
949439665 3:4066925-4066947 TCCTCTGCCCATTTCTCAACTGG + Intronic
950605531 3:14076069-14076091 CGCTCCCCCCATCTCACAACAGG - Intronic
951618235 3:24572000-24572022 CAATCCACCCATTTGACAAAGGG + Intergenic
951820460 3:26804432-26804454 CCCTCCCCCCATCCCACAACAGG - Intergenic
952362618 3:32646043-32646065 CCCTCCCCCCATCCCACAACAGG - Intergenic
952692640 3:36227703-36227725 CCCTCCCCCCATCCCACAACAGG - Intergenic
954433947 3:50486067-50486089 GCCCGGGCCCATTTCACAAACGG + Intronic
955514953 3:59717263-59717285 TCTTCTGCCCATTTCACAGATGG - Intergenic
955518982 3:59755976-59755998 TCCTACTCCCATTTTACAAAGGG - Intronic
956395026 3:68816158-68816180 CCCTCCCCCCACTCCACAACAGG - Intronic
956974174 3:74561019-74561041 CCCTCCCCCCATCCCACAACAGG - Intergenic
958705970 3:97655749-97655771 CCCTCCCCCCACTCCACAACAGG - Intronic
959039669 3:101406426-101406448 CCCTCCCCCCACTCCACAACAGG - Intronic
959939680 3:112067731-112067753 CAATCTACCCATTTCACAAAGGG - Intronic
960312868 3:116137891-116137913 CTCTCTGCCCATTTCACTTAAGG + Intronic
961456562 3:127027496-127027518 CCCACCGCCCATGGCACAAGCGG - Intronic
962818812 3:139026771-139026793 CCCTCCCCCCACTCCACAACAGG + Intronic
964370440 3:155994547-155994569 CCCTCCCCCAATTTCACAAATGG - Intergenic
964738392 3:159940179-159940201 CAATCTGCTCATTTCACAAAGGG + Intergenic
964810483 3:160658336-160658358 CCTTTTGCCCATTTCACAATGGG + Intergenic
964859935 3:161190459-161190481 CCCTCCCCCCATCCCACAATAGG + Intronic
965249197 3:166320103-166320125 CCCTCCCCCCACCCCACAAAAGG - Intergenic
966036489 3:175423414-175423436 CCCTCCCCCCATCCCACAACAGG + Intronic
967111104 3:186294784-186294806 CCTTACGTCCATTTCACCAAGGG + Intronic
967125161 3:186416687-186416709 CCCTCCCCCCACTCCACAACAGG + Intergenic
967336062 3:188345965-188345987 TCCTCCTCCCATCTCACAGATGG - Intronic
969903700 4:10373410-10373432 CCCTCCCCCCACCCCACAAAAGG - Intergenic
971750894 4:30646486-30646508 CCCTCCCCCCACTCCACAACAGG - Intergenic
971867538 4:32191391-32191413 CCCTCCCCCCACTGCACAACAGG - Intergenic
973103977 4:46308369-46308391 CCCTACCCCCACTCCACAAAAGG - Intronic
974024226 4:56718601-56718623 CCCTCCCCCCATGCCACAACAGG - Intergenic
974236891 4:59193049-59193071 CCCTCCGCCCACCCCACAACAGG - Intergenic
974521997 4:62994213-62994235 CCCTCCCCCCACTCCACAACAGG + Intergenic
975173759 4:71263011-71263033 CCCTCCCCCCACTCCACAACAGG + Intronic
975292010 4:72688235-72688257 CCCTCCCCCCATCCCACAACAGG - Intergenic
975527506 4:75366811-75366833 CCCTCCCCCCACCCCACAAAAGG - Intergenic
977917036 4:102605783-102605805 TCCTACACCCATTTCATAAAAGG - Intronic
978272109 4:106903335-106903357 CCCTCCCCCCACCCCACAAAAGG - Intergenic
978378128 4:108096759-108096781 CCATTTGCCCATTTTACAAAGGG - Intronic
979658448 4:123224358-123224380 CCCTCCCCCCATCCCACAACAGG + Intronic
981940794 4:150279791-150279813 TCCCCCACTCATTTCACAAATGG + Intronic
982934856 4:161460386-161460408 CCCTCCCCCCACCTCACAACAGG + Intronic
983706297 4:170664494-170664516 CCCTCCCCCCACCTCACAACAGG + Intergenic
983756057 4:171337716-171337738 CCCTCCCCCCACCCCACAAAAGG - Intergenic
984695153 4:182771486-182771508 CCCCCCCCCCATTTCAGAGACGG - Intronic
985108629 4:186523947-186523969 CCCTCCCCCCATCCCACAACAGG + Intronic
985299970 4:188478140-188478162 CCCTCCCCCCATCCCACAACAGG + Intergenic
987955245 5:24730207-24730229 CCCCCCGCCCTTTCAACAAAGGG - Intergenic
988332071 5:29855102-29855124 CCCTCCCCCCACCTCACAACAGG + Intergenic
988892933 5:35638981-35639003 CCCTTTTTCCATTTCACAAAAGG - Intronic
989302554 5:39911087-39911109 CCCTCCCCCCATCCCACAACAGG - Intergenic
989546546 5:42681201-42681223 CAATCCGCCCATCTGACAAAGGG + Intronic
989801321 5:45544598-45544620 CCCTCCCCCCATCCCACAACAGG + Intronic
989803889 5:45580686-45580708 CCCTCCGCCCACCCCACAACAGG + Intronic
990068970 5:51755647-51755669 CCCTCCCCCCATCCCACAACAGG + Intergenic
990447667 5:55907653-55907675 CAATCCCCTCATTTCACAAATGG + Intronic
990654831 5:57943498-57943520 CCCTCCCCCCATCCCACAACAGG + Intergenic
993313742 5:86372892-86372914 CCCTCCCCCCACCTCACAACAGG - Intergenic
993780208 5:92056999-92057021 CCCTCCCCCCATCCCACAACAGG + Intergenic
996199234 5:120650476-120650498 CCCTCCCCCCACTCCACAACAGG + Intronic
997620102 5:135282745-135282767 TCCTCTGCCCATTTTAAAAATGG + Intronic
998077923 5:139251443-139251465 TACTCCGCCCATTTTACAGATGG - Intronic
998157588 5:139795564-139795586 CCCTCCCCCCCTTTCTTAAAGGG + Intergenic
998501318 5:142635459-142635481 CCCCCCGCCCCTTCCACAGAAGG + Intronic
998722694 5:144972824-144972846 CCCTCCCCCCATTCCACAACAGG + Intergenic
998931199 5:147183348-147183370 CCCTCCCCCCACTCCACAACAGG + Intergenic
999065985 5:148686071-148686093 CCATTCACTCATTTCACAAATGG - Intergenic
999421437 5:151447895-151447917 CGCTTCGCCCAATTCACAGAGGG - Intronic
999497944 5:152118548-152118570 CCCTCTGCCCTTTTCTCATAAGG - Intergenic
1000497332 5:162001281-162001303 CCCTCCTCCCCTTACACAGATGG - Intergenic
1003410515 6:5858067-5858089 CCCTCCCCCCATCCCACAACAGG + Intergenic
1004840335 6:19576746-19576768 CCCTCCCCCCACTGCACAACAGG - Intergenic
1007274323 6:40662375-40662397 ATCTCCCTCCATTTCACAAAAGG + Intergenic
1008037566 6:46761930-46761952 CCCTCCCCCCACCTCACAACAGG + Intergenic
1009999528 6:70934385-70934407 CCCTTCTCCCACTTCACAAAGGG + Intronic
1010399543 6:75432829-75432851 CCCTCCCCCCACTTCCCAACAGG + Intronic
1011203460 6:84864631-84864653 CCCTCCCCCCATCCCACAACAGG + Intergenic
1012332303 6:98008279-98008301 CCCTCCCCCCACTCCACAACAGG + Intergenic
1015658547 6:135546902-135546924 CCCTCCGCCCATTGGTCACAGGG - Intergenic
1018539882 6:164867744-164867766 CCCTCCCCCCATCCCACAACAGG + Intergenic
1019914253 7:4122301-4122323 GCCTCCCCCCATTTCAAAAAAGG - Intronic
1021217487 7:17934701-17934723 CCCTTTGCCCATTTTAAAAATGG - Intronic
1022130552 7:27400900-27400922 CCCTCCCCCCACCTCACAACAGG + Intergenic
1022422280 7:30235029-30235051 CCCTCCCCCCACCTCACAAGAGG + Intergenic
1023873833 7:44276431-44276453 CCCGCCACCCACTGCACAAAGGG + Intronic
1026100427 7:67379570-67379592 CCATCGTCCCATTTCACAGATGG + Intergenic
1027539177 7:79446159-79446181 CCCTCCTCCCACTGCACAACAGG - Intronic
1027734137 7:81911269-81911291 CCCTCTCCCCATCCCACAAAAGG + Intergenic
1028081686 7:86585364-86585386 CCCTCCCCCCATCCCACAACAGG + Intergenic
1028138120 7:87243991-87244013 CCCTCCCCCCACCCCACAAAAGG - Intergenic
1028513431 7:91650209-91650231 CCCTCCCCCCACTCCACAACAGG - Intergenic
1028669210 7:93381867-93381889 CCCTCCCCCCACCTCACAACAGG - Intergenic
1033840150 7:145363045-145363067 CCCTCCCCCCACCTCACAACAGG - Intergenic
1036686819 8:10917301-10917323 CCCTCTCCCCATTTAACACAGGG - Intronic
1037043744 8:14271040-14271062 CGCTCCGCCCACCTCACAACAGG - Intronic
1037135703 8:15457160-15457182 CCCTCCCCCCACCTCACAACAGG - Intronic
1039155130 8:34546223-34546245 CCCTCCCCCCATCCCACAACAGG - Intergenic
1040984461 8:53278830-53278852 CCCTCCCCCCATCCCACAACAGG + Intergenic
1043658279 8:82701417-82701439 CCCTCCCCCCATCCCACAACAGG + Intergenic
1044766971 8:95586837-95586859 CCCTCCTCCCCTTTCAGGAAAGG - Intergenic
1045072526 8:98523674-98523696 CCCTTTGCCCATTTCTGAAATGG + Intronic
1045251608 8:100487425-100487447 CCCTCCTCCCACCTCACAAGAGG - Intergenic
1045998137 8:108387317-108387339 CCCTCCCCCCACCTCACAACAGG - Intronic
1046657475 8:116911035-116911057 CCCTCCCCCCACCCCACAAAAGG - Intergenic
1047167291 8:122453327-122453349 CCCTCCCCCCATCCCACAACAGG + Intergenic
1047501319 8:125443968-125443990 CACTCCTCCCATTTTACAGATGG + Intergenic
1049452658 8:142670268-142670290 CCCTGCGCCCATTCTACAGATGG - Intronic
1050924764 9:11249835-11249857 CCCTCCCCCCATCCCACAACAGG - Intergenic
1051018836 9:12515691-12515713 CCCTCCCCCCACCTCACAACAGG - Intergenic
1051869611 9:21722173-21722195 CCCTCCTCCCATCCCACAACAGG - Intergenic
1052054872 9:23894038-23894060 CCCTCCCCCCACCTCACAACAGG + Intergenic
1052298467 9:26926316-26926338 TCCTCCCTCCATCTCACAAATGG + Intronic
1053345892 9:37378027-37378049 CCCTCACCTCATTTTACAAAGGG + Intergenic
1054879177 9:70127031-70127053 CCCTCAGCCAACTTCACAAAGGG + Intronic
1055317779 9:75051246-75051268 CCCTCTTCCTATTTTACAAATGG - Intergenic
1056892498 9:90508996-90509018 CCCTCCTCCCAGTTCAGATATGG + Intergenic
1057186234 9:93058864-93058886 CTCTGCGCCCATTTCACAGACGG + Intronic
1058604392 9:106705186-106705208 CCCTCCCCCCACCTCACAACAGG + Intergenic
1058683395 9:107459582-107459604 CCAACCGCCCATTTAAAAAAGGG + Intergenic
1062385286 9:136306932-136306954 CTCTCCGCCCACTTTACAGAGGG - Intergenic
1187844236 X:23520272-23520294 CCCTCCCCCCACTACACAACAGG + Intergenic
1190058714 X:47197291-47197313 CCCTATGCCCAAATCACAAATGG - Intronic
1190561664 X:51692287-51692309 CCTTATCCCCATTTCACAAATGG + Intergenic
1190562627 X:51701018-51701040 CCTTATCCCCATTTCACAAATGG - Intergenic
1190941600 X:55047076-55047098 CCCTCCCCCCATCCCACAACAGG + Intergenic
1191935001 X:66417939-66417961 CACTCCGCCCACCTCACAACAGG + Intergenic
1192003680 X:67186607-67186629 CCCTCCCCCCACCCCACAAAAGG + Intergenic
1192082864 X:68064985-68065007 CCCTCCGCCCACCTCACAACAGG - Intronic
1193044767 X:77040585-77040607 CCCTCCCCCCACCTCACAACAGG - Intergenic
1193051048 X:77100228-77100250 CCCTCCCCCCACTCCACAACAGG + Intergenic
1193131758 X:77927776-77927798 CCCTCCCCCCATCCCACAACAGG + Intronic
1193566526 X:83083818-83083840 CCCTCCCCCCACTCCACAACAGG + Intergenic
1197469632 X:126851390-126851412 CCCTCCCCCCATCTCACAATAGG - Intergenic
1197678507 X:129357041-129357063 CAATCCACCCATCTCACAAAGGG + Intergenic
1197797125 X:130309687-130309709 CCCTCCACCCATTTTATACAGGG + Intergenic
1197878181 X:131133991-131134013 CCCTCCCCCCACCTCACAACAGG + Intergenic
1198120830 X:133590940-133590962 CACTCCCTCTATTTCACAAATGG + Intronic
1199847147 X:151699819-151699841 CCTTCCATCCCTTTCACAAAGGG + Intronic
1201344837 Y:12971633-12971655 CCCTCCCCCCACCCCACAAAAGG + Intergenic
1201418954 Y:13776982-13777004 CCCTCCCCCCACCTCACAACAGG + Intergenic