ID: 1175888574

View in Genome Browser
Species Human (GRCh38)
Location 20:62305966-62305988
Sequence ACACCCGGGATTGCGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888564_1175888574 9 Left 1175888564 20:62305934-62305956 CCATTTGTGAAATGGGCGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 315
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888557_1175888574 29 Left 1175888557 20:62305914-62305936 CCTTCGGAGCTCTAGGCTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888562_1175888574 10 Left 1175888562 20:62305933-62305955 CCCATTTGTGAAATGGGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30
1175888561_1175888574 11 Left 1175888561 20:62305932-62305954 CCCCATTTGTGAAATGGGCGGAG 0: 1
1: 0
2: 6
3: 84
4: 633
Right 1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888574 Original CRISPR ACACCCGGGATTGCGGCGGA TGG Intronic
903360147 1:22772029-22772051 ACACCAGGGCTTGCTGGGGAAGG - Intronic
905553018 1:38859325-38859347 ACGCCCGGGAGGGCGGCGGCCGG - Intronic
918276147 1:182955390-182955412 CCACTTGGGATTGCGGCAGAAGG - Intergenic
1068783113 10:60943479-60943501 AGACACGGGGTTGCGGGGGAGGG + Intronic
1069060498 10:63889525-63889547 ACACACTGGATTGAAGCGGAAGG - Intergenic
1073433178 10:103500058-103500080 ACCCCCGGGAATGCAGCAGACGG + Intronic
1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG + Exonic
1142390436 16:89796283-89796305 ACACCCGGGAGTGGAGCAGAAGG + Intronic
1151907248 17:77056561-77056583 ACACCCGGGACTCCGGGGGGAGG - Intergenic
1160514059 18:79468932-79468954 ACCCCCGGGATTGTGGGGAAGGG + Intronic
1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG + Intronic
1163851932 19:19669128-19669150 ACACCCGGGGTCCCGGCGGCTGG - Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
929672032 2:43883765-43883787 ACACCGGGGATTGAGGCCCAAGG - Intergenic
944675511 2:202032391-202032413 GCACCCGGGACTGAGGCAGAAGG + Intergenic
948721342 2:239902846-239902868 ACAGCCAGGATTCCTGCGGAAGG + Intronic
1171363033 20:24603587-24603609 ACGCCTGGGATGGCAGCGGAGGG + Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1184031625 22:41898487-41898509 ACACCCAGGATTCTGGGGGAGGG - Intronic
1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG + Intronic
952258770 3:31718816-31718838 AGACCCGGGATGGGGACGGAAGG + Intronic
955803244 3:62707317-62707339 AGACCCGGGGTTGCAGGGGATGG - Intronic
968640597 4:1712574-1712596 ACCCGCGGGATTGAGGCGGCCGG + Intergenic
985994627 5:3591168-3591190 CCACCCGGGAACGCGGCGGGCGG - Intergenic
1007631988 6:43277666-43277688 ACACCCAGGAATGCCGGGGAAGG - Intronic
1011195479 6:84774901-84774923 ACGCCAGGCAGTGCGGCGGACGG - Intergenic
1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG + Intergenic
1035345233 7:158193051-158193073 ACAGCAGGGACTGCAGCGGAGGG - Intronic
1036808686 8:11852726-11852748 TCTCCCGGGATGGCGGTGGATGG + Intronic
1038454930 8:27666958-27666980 ACACCCTGGAGTCCGGTGGAGGG - Intronic
1060519377 9:124285600-124285622 ACAGCCGAGATTGAGGAGGATGG + Intronic