ID: 1175888797

View in Genome Browser
Species Human (GRCh38)
Location 20:62306985-62307007
Sequence CTGGAGGACTGGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 1, 2: 0, 3: 54, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175888781_1175888797 21 Left 1175888781 20:62306941-62306963 CCAGCTGGGTACTTCAGAGGAGG 0: 1
1: 1
2: 1
3: 3
4: 157
Right 1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG 0: 1
1: 1
2: 0
3: 54
4: 516
1175888779_1175888797 23 Left 1175888779 20:62306939-62306961 CCCCAGCTGGGTACTTCAGAGGA 0: 1
1: 0
2: 2
3: 20
4: 174
Right 1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG 0: 1
1: 1
2: 0
3: 54
4: 516
1175888780_1175888797 22 Left 1175888780 20:62306940-62306962 CCCAGCTGGGTACTTCAGAGGAG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG 0: 1
1: 1
2: 0
3: 54
4: 516
1175888792_1175888797 -10 Left 1175888792 20:62306972-62306994 CCGAGCGGTGGGGCTGGAGGACT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG 0: 1
1: 1
2: 0
3: 54
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175888797 Original CRISPR CTGGAGGACTGGAGGGAGCT GGG Intronic
900416126 1:2535558-2535580 GTGGAGGGCTGCAGGGAGCGGGG - Intergenic
900487660 1:2931119-2931141 GTGTAGGCCTGGAGGGACCTCGG + Intergenic
900495247 1:2973188-2973210 CTGGGGGACTGATGGCAGCTGGG + Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
901195089 1:7435940-7435962 CAGGAGCAGAGGAGGGAGCTGGG + Intronic
901213652 1:7540993-7541015 CTGGAGAACTGGAGGTTGCAGGG + Intronic
901730097 1:11273140-11273162 CTGGAGGGCGGGAGGGGGCGGGG - Intergenic
901919823 1:12528069-12528091 CTGGATGACAGGAGGGAGCCAGG + Intergenic
902834466 1:19037750-19037772 ATGGAGGGCTGGAGGTAACTTGG - Intergenic
902857941 1:19222706-19222728 CTGGAGGACCTGGGGCAGCTGGG + Exonic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903565520 1:24262461-24262483 CTGGAGCCTTGGAGGGAGCATGG - Intergenic
903931299 1:26863981-26864003 GTGGGGGACTGGAGGGGGCAGGG - Exonic
904042613 1:27593221-27593243 CTGGAGGAGTGGAGGGGGAGGGG - Intronic
904481791 1:30798598-30798620 CGGGAGGGCTGGACTGAGCTGGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
904774802 1:32900203-32900225 CTGGAGCACTGGACTGAGCCTGG + Intronic
904833422 1:33320150-33320172 CTGGAGGGCTGGCTGCAGCTGGG + Intronic
904835217 1:33331316-33331338 CTGGGGAAATGGAGGGGGCTGGG + Intronic
906125486 1:43424682-43424704 CTTGAGGACTGCTGGGAGGTGGG + Intronic
906144959 1:43554483-43554505 CTTGAGGACAGGTGGGAGTTGGG + Intronic
907451456 1:54548175-54548197 CTGGTGGGCGGGCGGGAGCTGGG + Intronic
908151662 1:61309096-61309118 TTGGAGGAAAGGAGGAAGCTGGG - Intronic
908683282 1:66686214-66686236 CTGGAGCAGTGGAAGCAGCTGGG - Intronic
909980634 1:82096053-82096075 CTGGAGGTCTAGGGTGAGCTGGG + Intergenic
911042401 1:93600992-93601014 GTGGAGGAGAGGAGAGAGCTTGG + Intronic
911088125 1:93996425-93996447 CTGGAGGACTCAAGGGACTTGGG + Intronic
911197990 1:95015215-95015237 ATGGAGATCTGCAGGGAGCTGGG + Intronic
911450351 1:98053927-98053949 CGGGAGGACAGCAGAGAGCTCGG - Intergenic
913023445 1:114810200-114810222 CTGGAGATATGGACGGAGCTGGG + Intergenic
914899340 1:151703510-151703532 CTGGGGGAGGGGAGGGGGCTGGG + Intronic
915113148 1:153577641-153577663 GTGGAGGACTGGGGGGAGTTGGG - Intergenic
915288367 1:154867146-154867168 AGGGAGGACTGGAGAGAGCCAGG + Intronic
915557779 1:156669890-156669912 CAGGAGGAGGGGAGGGAGCCAGG - Exonic
915645100 1:157264876-157264898 CTGGAGGAAGTGAGGGAGCCTGG + Intergenic
915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG + Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916576249 1:166069790-166069812 CTGTCTGACTGGAGGGTGCTGGG - Intronic
917201152 1:172516898-172516920 GAGGAGTAATGGAGGGAGCTGGG - Intergenic
917826405 1:178825892-178825914 CTGGAGGATTTTAGGGAGCAGGG + Intronic
918105079 1:181409979-181410001 CTGGTGGCCTGGTGAGAGCTGGG + Intergenic
919745187 1:201004360-201004382 CTGGAGGAGCCGAGTGAGCTTGG + Exonic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG + Intronic
920931702 1:210394749-210394771 CTGGAAGGCTGCAGGGAGCAGGG + Intronic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921456436 1:215377586-215377608 CTGCAGAATTGGAGGGAACTTGG + Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921675185 1:217968563-217968585 CAGGAGGTCTGAAGGTAGCTTGG + Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922452321 1:225747036-225747058 CTGGAGGACTGAAGAGGGTTGGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923096250 1:230777590-230777612 GTAGAGGACAGGAGAGAGCTGGG - Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063120861 10:3104969-3104991 CAGGAGGCCTGCAGGGACCTAGG - Intronic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1064263389 10:13804453-13804475 CTGGTGCACGGGAGCGAGCTTGG - Intronic
1065115173 10:22477301-22477323 CTGGTGGAGGGGAGGGAACTGGG - Intergenic
1066119172 10:32267267-32267289 CGCCAGGGCTGGAGGGAGCTGGG - Intergenic
1066596260 10:37053315-37053337 CCAGAAGACTGGAGGAAGCTAGG - Intergenic
1067062506 10:43085086-43085108 CTGGAGGCCAGCATGGAGCTGGG + Intronic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1070242778 10:74699624-74699646 CTGGAGTACTGGTGTGATCTTGG - Intronic
1070427858 10:76306988-76307010 GTGGAGGAGTGGAGGAAGCCTGG + Intronic
1070594403 10:77821908-77821930 CTGGAAGACAGGAAGGAGCCAGG - Exonic
1070724469 10:78778784-78778806 CAGGAGGACAGATGGGAGCTGGG + Intergenic
1070826580 10:79393807-79393829 CTGGAGGATGGGGGGAAGCTAGG - Intronic
1070972507 10:80579105-80579127 CTGGAGGAGAGGTGAGAGCTTGG + Intronic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1072040229 10:91600109-91600131 CTGGAGTGCTGCAGGGAGCCTGG - Intergenic
1072553780 10:96498832-96498854 GTGGCAGACTGGAAGGAGCTTGG + Intronic
1073119097 10:101110814-101110836 CTGGAGTGCTTGAGGAAGCTGGG + Intronic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1073326871 10:102648236-102648258 TTGAAGGACTGGTGGGAGCTGGG + Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1074199331 10:111220391-111220413 GTGGAGAAAAGGAGGGAGCTGGG + Intergenic
1075192157 10:120319460-120319482 CTGGAGAACAGAAGAGAGCTGGG + Intergenic
1075686376 10:124367757-124367779 CTGGAGGACAGGGGTGCGCTGGG - Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076214243 10:128679961-128679983 ATGGAGGACTGGAGGCAGAGAGG + Intergenic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076505594 10:130970852-130970874 CTGGGGGACTGGAGGGGCCTCGG + Intergenic
1076943457 10:133626098-133626120 CTGGAGAACAGAAGAGAGCTGGG - Intronic
1077483050 11:2825470-2825492 CTGGACGACTGGAGGGACACTGG - Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1078563609 11:12394748-12394770 CTGCAGGACTTGAGTGTGCTCGG - Intronic
1078855973 11:15206631-15206653 CTGGAGGACTGGAGCTGGCAAGG + Intronic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079022807 11:16923512-16923534 CTGGAAGGCTGGAGTGAGGTAGG + Intronic
1080433301 11:32217779-32217801 CTGGAGGACAGAGGTGAGCTGGG - Intergenic
1081773603 11:45664171-45664193 CTGGAGGGGTGGGAGGAGCTGGG - Intronic
1081832112 11:46122182-46122204 CTGTTGCACTGGAGGGAGTTGGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1083243162 11:61404577-61404599 CTGGGTGTCTGGAGGGAGTTAGG + Exonic
1083304139 11:61753987-61754009 CTTAGGGACTAGAGGGAGCTCGG - Intronic
1083620390 11:64046429-64046451 CAAGGGGACAGGAGGGAGCTGGG + Intronic
1083997642 11:66279962-66279984 TCTAAGGACTGGAGGGAGCTGGG + Intronic
1084161773 11:67353968-67353990 CTGGAGGTCTGAAGAGAGTTTGG + Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085579401 11:77637476-77637498 CTGGAGGCCTGCTGGGAGCGGGG - Intronic
1085690481 11:78660079-78660101 CTGGAGTGCAGGAGGGAGCCTGG + Intronic
1085855257 11:80169053-80169075 CTGGAAGACTGGATGGGGCAGGG - Intergenic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086424179 11:86668043-86668065 CTAGACTCCTGGAGGGAGCTTGG + Intronic
1087008695 11:93493545-93493567 CTGGAGGAAGGGAGGCATCTGGG - Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1088201233 11:107337508-107337530 CTGTAGTACAGGATGGAGCTAGG + Intronic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1088752810 11:112859144-112859166 CTGGAGGACTGGCTGCATCTTGG + Intergenic
1089082418 11:115788004-115788026 CTGGAGGACTGGCCTGTGCTGGG + Intergenic
1089177971 11:116561859-116561881 CTGAAGGGCTTGAGAGAGCTGGG + Intergenic
1089644889 11:119872402-119872424 CTGGAGGGCAGGAAGGAGCCAGG - Intergenic
1090648540 11:128786597-128786619 CTGGAGGACGGGAGAGAACAAGG - Intronic
1090744096 11:129693055-129693077 CTGCAGGACTGCTGGGAGCATGG - Intergenic
1090787662 11:130064389-130064411 CTGGAGTCCAGGAGGCAGCTAGG - Intergenic
1090958736 11:131537081-131537103 CTGCAGACCTTGAGGGAGCTGGG + Intronic
1091294865 11:134466564-134466586 CTGCAGGACAGGAGTGAGCGAGG + Intergenic
1091639101 12:2221042-2221064 CTGGAAGACAAGAAGGAGCTAGG + Intronic
1091639698 12:2226755-2226777 CTCGAGAACTGGAGGGAGATGGG - Intronic
1091657952 12:2359607-2359629 CTTGGGGACTGGAGAGAACTTGG + Intronic
1091671309 12:2454061-2454083 CTGGAGGGCTCCAGGGAGGTGGG - Intronic
1091696338 12:2630585-2630607 CTGGAGGACTGAGGGGCTCTGGG + Intronic
1093484754 12:19640884-19640906 ATGGAGGCATGGAGGGAGCGCGG - Intronic
1094493441 12:30975500-30975522 CAGGAGGAGGGGAGAGAGCTTGG - Intronic
1094685249 12:32706178-32706200 TTGGAGGACTGGAGTAATCTAGG - Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095983911 12:47987356-47987378 CTGGAGGGCTGGAGGTGGTTGGG - Intronic
1099222735 12:79934514-79934536 CTGGTGGAAGGGAGGGCGCTGGG - Intronic
1100027974 12:90152687-90152709 CTGGGGTACTGCAGGGAACTGGG - Intergenic
1100709114 12:97235092-97235114 CAGGAAGACTCCAGGGAGCTGGG - Intergenic
1100848193 12:98681529-98681551 CTGGAGTACTGGATGTAGCTAGG + Intronic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1102543443 12:113638337-113638359 CTGGAGGGATGGAGAGGGCTTGG + Intergenic
1102614491 12:114141516-114141538 CTGGAACACTGGAAGGGGCTGGG - Intergenic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103505317 12:121439177-121439199 CTGGTGGGCAGGAGGGAGCTTGG - Intronic
1103948890 12:124541150-124541172 GTGGAGAGCTGGAGGGAGATGGG + Intronic
1104680525 12:130748147-130748169 CTGGAGGCCTGCATGGAGCAGGG - Intergenic
1104692725 12:130839000-130839022 CTGGAGGGCGGGCGGGGGCTCGG - Intronic
1106755735 13:32821289-32821311 CTTGAGGACTAGAGGAAGCTGGG + Intergenic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1107049107 13:36028510-36028532 CTGGAGGGCGGGAGGAAGCAAGG - Intronic
1108150358 13:47527406-47527428 CTGGGGGACCTGAGGGACCTGGG - Intergenic
1108505329 13:51107782-51107804 CTGGTGGACTGCAGTGAACTTGG - Intergenic
1110832306 13:80045434-80045456 CTGGAGGAATGGAGGATGATGGG - Intergenic
1113386615 13:109854586-109854608 ATTGAGTCCTGGAGGGAGCTTGG + Intergenic
1113677111 13:112214896-112214918 CTGGAGGGGAGGAGGGAGATGGG + Intergenic
1113693225 13:112326624-112326646 CTGGAGGCCTGGAGTCAGCGGGG + Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1113812892 13:113153211-113153233 CAGGAGGACGGGCGGGAGCGGGG + Intergenic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1116726303 14:48565330-48565352 CTGGAGGCGGGGAGGGGGCTTGG + Intergenic
1117667394 14:58070844-58070866 GTGGAGGATTCAAGGGAGCTGGG - Intronic
1118312532 14:64704436-64704458 CGGGAGGGCAGGAGGGAGCGAGG - Exonic
1118836883 14:69484335-69484357 GTGGAGGAGAGGACGGAGCTAGG - Intergenic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1119787405 14:77323814-77323836 CCGGAGGACTGCTGGGAGGTGGG + Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121095601 14:91216094-91216116 CGGGAGGAATGGGGGGAGCAGGG + Intronic
1121115391 14:91339389-91339411 CTGGAGGACTTGATGGGGCTGGG + Exonic
1121709674 14:96028159-96028181 CAGGAGAGCTGGAGGGGGCTAGG - Intergenic
1122081182 14:99268976-99268998 CCAGAGGACTGGTGGCAGCTGGG - Intronic
1122899822 14:104777808-104777830 CTGGGGGCCAGGAGGGGGCTCGG + Intronic
1122901599 14:104784419-104784441 CAGGAGGAGTCGAGGGAGCCTGG - Intronic
1123043248 14:105499181-105499203 CTGGTGGTCTGGAGGGGACTCGG + Intronic
1123696067 15:22880069-22880091 TTGGGGGACTGGAGGGGGCCGGG + Intronic
1125609356 15:40960317-40960339 CTGGAGGAAAGGCAGGAGCTGGG + Intergenic
1125894176 15:43288061-43288083 CTGGAGGACTTGAAGAAGCAGGG + Intronic
1126397858 15:48238320-48238342 CTGGAGCTCTGAAAGGAGCTAGG + Intronic
1127796779 15:62445186-62445208 CTGAAGGCCTGGAGTCAGCTGGG - Intronic
1127855483 15:62950285-62950307 CTGGAGGAGAGGAGTCAGCTGGG + Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128767946 15:70262473-70262495 CTGGAGAGCTGGAGAGAGCCAGG + Intergenic
1129169222 15:73797735-73797757 CTGCAGGACTGGCAGGAGCGGGG + Intergenic
1129336116 15:74853215-74853237 GTGGTGGGCTGTAGGGAGCTGGG - Intronic
1129687102 15:77692774-77692796 CTGGAGCACTGCAGGCAGCAGGG - Intronic
1129694293 15:77731825-77731847 GTGCTGGACAGGAGGGAGCTGGG - Intronic
1129770701 15:78201565-78201587 CTGAAGGGCAGGAGTGAGCTTGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130159562 15:81385212-81385234 CTGCAGGCCTGAAGGGAGGTGGG + Intergenic
1130622277 15:85476132-85476154 CTTGAGGACTGGACTGAGCATGG + Intronic
1131260366 15:90884564-90884586 CTGGAGGAGCGGTGGGAGCTGGG + Intronic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1132302430 15:100784309-100784331 CTGGAGAACTGGAGGAGGCCTGG + Intergenic
1132887647 16:2189615-2189637 CTGGAGGATAGGGGGGTGCTGGG + Intronic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1133106702 16:3515306-3515328 CTTGAGCTCTGGAGAGAGCTGGG + Intronic
1134059078 16:11188221-11188243 CTGGAAGACTGGTGGGGGCCTGG + Intergenic
1134411157 16:14004063-14004085 ATGGAGGACTGGTGGGAGGCAGG + Intergenic
1135033364 16:19056624-19056646 ATGAAGGACTGCAGCGAGCTGGG - Exonic
1135048608 16:19174124-19174146 TTGGAGGACAGGATGGAGCCTGG - Intronic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1137769284 16:51003293-51003315 AGAGAGGCCTGGAGGGAGCTGGG + Intergenic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1138585988 16:57970844-57970866 CAGGAGGACTTGGGGGACCTAGG - Intronic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1141088457 16:81113445-81113467 CTGCAAGACTGGAGGGAGGCAGG + Intergenic
1141173689 16:81705986-81706008 CAGGAGGTCTGGAGTGGGCTTGG - Intronic
1141177960 16:81733079-81733101 CTGGAGGACAGGAGTGAACCCGG + Intergenic
1141733351 16:85836657-85836679 CTGGTGAGCTGGTGGGAGCTGGG + Intergenic
1142794322 17:2295726-2295748 CTGGAGGTCAGGAGAAAGCTGGG - Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143181997 17:4989136-4989158 CTGGAGGACAGTGGGGAGGTTGG - Intronic
1143182836 17:4994432-4994454 CTGCATGACTGGACGGGGCTGGG + Exonic
1143309120 17:5973683-5973705 CTGGATGACTGAACTGAGCTGGG + Intronic
1144007523 17:11114668-11114690 AGGGAGGACTAGGGGGAGCTTGG + Intergenic
1144058098 17:11559191-11559213 CTAGAGGCCTGGAGGGAGTGCGG - Exonic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144482405 17:15638812-15638834 CTAGAGGTTTGGAGGGAGATGGG + Intronic
1144826072 17:18106410-18106432 CTGGAGGACAGGAGAGAGTCAGG - Intronic
1144916278 17:18726220-18726242 CTAGAGGTTTGGAGGGAGATGGG - Intronic
1145115905 17:20210782-20210804 GTGGAGGTGTGGTGGGAGCTGGG - Intronic
1145268294 17:21391085-21391107 CTGGAGGACATGATGGAGATGGG - Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145321050 17:21767615-21767637 CTGGAAGAATGGGGGGAGCACGG + Intergenic
1146290115 17:31600734-31600756 ATGGAGGACTGGAGTGGGGTAGG - Intergenic
1146484006 17:33228877-33228899 CTGGAGGACAGGGAGGAACTTGG - Intronic
1146642847 17:34554095-34554117 GTTCAGGACTGGGGGGAGCTGGG + Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147164627 17:38586677-38586699 ATGGAGCCCTGGAGGGAGCTGGG + Intronic
1147212574 17:38880467-38880489 CTGGAGGCCAGGAGGGAGACAGG - Intronic
1147252083 17:39158723-39158745 CTGGAGGATTTTAAGGAGCTGGG - Intronic
1148085929 17:44993849-44993871 CTGCAGTGCTGGTGGGAGCTGGG - Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148347801 17:46915251-46915273 CTGGAAGACTGGACTCAGCTGGG + Intergenic
1148907592 17:50921103-50921125 CTGGAGGACAGGAGAGACTTTGG - Intergenic
1149568644 17:57656750-57656772 CTGGGGAACTGGAGGAAACTAGG - Intronic
1149575236 17:57707270-57707292 CTGGAGGCTGGGAGGGAGATGGG - Intergenic
1149661217 17:58334956-58334978 CAGGGTGACTGGAAGGAGCTGGG + Intergenic
1150335473 17:64327500-64327522 CTGGAGGCCAGGAGGCAGCTGGG - Intronic
1151379032 17:73712150-73712172 CTGGAAGGCTGGCGGGAGCCAGG - Intergenic
1151554438 17:74839465-74839487 CTGGAAAGCTGGAGAGAGCTTGG + Exonic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152080455 17:78184198-78184220 CTGGTGGAGTGGAGGGTGCTTGG - Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152744890 17:82034037-82034059 CCGGAGGCCGGGAGGGAGCAGGG + Exonic
1152825441 17:82461956-82461978 TTGGAGCCCTGGAGGCAGCTGGG + Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1153468275 18:5414656-5414678 CAGGAGGGCTGCAGGGAGCCTGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1153748031 18:8200299-8200321 TTGGAGGTGGGGAGGGAGCTGGG + Intronic
1153873740 18:9346147-9346169 CTAGGGGACTGGGGGGAGGTAGG - Intronic
1153980280 18:10302884-10302906 CAGGTGGACTGGAGGGGGCTGGG - Intergenic
1154177515 18:12094626-12094648 GTGGAGGACTGGTGGGGGGTGGG + Intronic
1154381468 18:13854586-13854608 CTGGAGTACTGGAGTAAGCTGGG + Intergenic
1155388567 18:25308230-25308252 CTGGTGGCCTGGATGGGGCTGGG - Intronic
1156765020 18:40642303-40642325 TTGGAGGAATGGAGGTAGGTGGG - Intergenic
1156839131 18:41590625-41590647 CTGGAGGAGGGGAGGAACCTTGG - Intergenic
1156902001 18:42310826-42310848 GTGGAAGACTGGAGGGAGAGAGG - Intergenic
1158009913 18:52716741-52716763 AAGGAGGACTACAGGGAGCTAGG - Intronic
1159066048 18:63568694-63568716 CTGAACGACTGGTGGCAGCTGGG - Intergenic
1159872135 18:73770244-73770266 CTGGAAGACAGGAGGAAGATGGG + Intergenic
1159951332 18:74486413-74486435 CTGGTGGCCTGGAGGGAGCCTGG + Intergenic
1160531589 18:79568138-79568160 GCGGAGAAGTGGAGGGAGCTGGG - Intergenic
1160669174 19:348637-348659 CTGTAGGATTGGAGGCGGCTTGG + Intergenic
1160752553 19:741362-741384 CTGGAGGGCTGAGGGGAGTTGGG + Intronic
1160768710 19:821172-821194 CTGGGGGCCTGGAGGGGGCGGGG - Intronic
1160797481 19:952739-952761 CTGGGAGACTGGAGGGGGCCTGG + Intronic
1161025589 19:2035218-2035240 CTTGAGGCCTGGAGGGGGCGAGG - Intergenic
1161058750 19:2203742-2203764 CTGGAGGGCTGGCAGGGGCTGGG - Intronic
1161183569 19:2901208-2901230 CTGGAGGACTGGGGGCAGTTTGG + Intronic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161563500 19:4986608-4986630 CGTGAGGACTGGAGAGAGCCTGG + Intronic
1162106114 19:8370910-8370932 CTGGAGGACTCGAGGAGGGTGGG - Intronic
1162259411 19:9520106-9520128 GTGGAGGAATGGAGGCAGCCAGG + Intergenic
1162341405 19:10093504-10093526 CTGGAGGACTGGGGGGGCCGTGG - Exonic
1162433687 19:10644121-10644143 CTGCTGGGCTGGAGGGAGTTAGG + Exonic
1162823336 19:13236468-13236490 GGGGAGGACGGGAGGGAGCTGGG + Intronic
1163184742 19:15629486-15629508 CTGGAGGACTGCGGGGATCTAGG + Exonic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164853855 19:31505425-31505447 CGGGAGGACTGCGGGCAGCTGGG + Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165804498 19:38572333-38572355 CTGGAGCACTGGCTGGGGCTGGG + Intronic
1165828400 19:38718673-38718695 CTGAAGTGCTGGAGGGGGCTTGG - Intronic
1165949909 19:39468557-39468579 GTGGAGGAGTGCAGGGAGGTGGG + Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166571042 19:43797612-43797634 CAGGAGGACTGGGAGGAGCAGGG + Exonic
1166775783 19:45311691-45311713 TTGCAGGACTGGAGGAGGCTGGG + Intronic
1167295119 19:48645308-48645330 CTGGGGGGGAGGAGGGAGCTGGG + Intronic
1167477737 19:49710638-49710660 CTGGAGGTCTGGACAGAGATAGG + Intronic
1167644811 19:50699974-50699996 TTGGAGGATTGGAGGGATCGGGG + Intronic
1167644842 19:50700074-50700096 TTGGAGGATTGGAGGGATCGGGG + Intronic
1168075169 19:53977308-53977330 CTGCAGAACTGGACAGAGCTGGG + Intronic
925030522 2:647238-647260 CTGTAGGTCTGGACGGGGCTGGG + Intergenic
925900021 2:8502608-8502630 CTTGAGGACTGGAGGGCCCACGG - Intergenic
926206167 2:10835512-10835534 CTGGAGGCCTGAAGGCAGGTGGG + Intronic
926327824 2:11800282-11800304 TTCTAGGACTGGAAGGAGCTGGG + Intronic
926503491 2:13682674-13682696 CTCGAAGAGGGGAGGGAGCTTGG - Intergenic
927519597 2:23690874-23690896 CTGGGGAACTGGGGGGAGCAGGG - Intronic
928441862 2:31298797-31298819 CTCGGGGGCTGGAGGGAGATGGG + Intergenic
928452979 2:31395290-31395312 CAGGATGGCTGGAGGGGGCTGGG + Intronic
928923052 2:36545992-36546014 CTGGAGGGGTGGTGGGAGCAGGG - Intronic
929336937 2:40760238-40760260 CTGGAGGACAGCAGAGAGCCAGG - Intergenic
929564382 2:42975442-42975464 CTGGAGGGCTGGAGGAAGACAGG - Intergenic
929863538 2:45699145-45699167 GAGGAGGACAGGAGGGAGTTGGG - Intronic
931757916 2:65390391-65390413 CTGTGGGACTGGAGTGAGCCTGG + Intronic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932423584 2:71615287-71615309 CAGCAGCACTGGTGGGAGCTGGG + Intronic
933804513 2:85988493-85988515 CTGGAGCACAGGTGGGAGATGGG - Intergenic
934515182 2:94981873-94981895 CTGGAGTACAGCATGGAGCTTGG - Intergenic
935200191 2:100849749-100849771 CTGGAAAACTGGAGAGAGGTTGG + Intronic
937919957 2:127121997-127122019 TTGGCAGCCTGGAGGGAGCTGGG + Intergenic
938339801 2:130527825-130527847 CTGGAGGACGGAAGGGACCAGGG - Exonic
938350035 2:130592925-130592947 CTGGAGGACGGAAGGGACCAGGG + Exonic
942526894 2:176862260-176862282 CTGGAGGACTGGAGACTGGTTGG + Intergenic
942752549 2:179304237-179304259 CTGGAGAACAGCAGGGAGGTGGG - Intergenic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
943477202 2:188372223-188372245 CTGGAGAACTAGATGCAGCTGGG - Intronic
947111203 2:226721403-226721425 CAGGAGAGCTGGAGGGAGCAAGG + Intergenic
947832480 2:233151417-233151439 CGGGAGGACTGGAGCTAGGTGGG - Intronic
947933826 2:233985991-233986013 TTGGTGGACTGGAGGGAGTGGGG + Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948561556 2:238857087-238857109 AAGGACCACTGGAGGGAGCTTGG + Intronic
948884474 2:240875912-240875934 CTGGAAGACACGAGGGGGCTTGG - Intronic
948931217 2:241133571-241133593 CACGGGGACTGGAGGGAGCCAGG - Intronic
948931521 2:241135334-241135356 CTGTGGGACTTGAGGGTGCTCGG - Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169150386 20:3285002-3285024 GTGGAGGGCAGGAGGGAGGTGGG - Intronic
1169209092 20:3755729-3755751 CTGGAGTGATGGAGGGAGTTGGG - Intronic
1169519415 20:6355033-6355055 CTGGAAGACTAGTGGGGGCTTGG - Intergenic
1169819784 20:9697436-9697458 CTAGAAGACTGGTGGGAGCTAGG - Intronic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1171780828 20:29416266-29416288 CTGGAGAACAGAAGAGAGCTGGG - Intergenic
1172080487 20:32336956-32336978 CTAGAGGACAGGAGTTAGCTGGG + Intergenic
1172094583 20:32454435-32454457 CTGGAGGACAGGAGACTGCTGGG - Intronic
1172177405 20:32980653-32980675 TTGGAGGACAGGAGGGAGTGTGG + Intergenic
1172211012 20:33198597-33198619 CTGAAGGAAGGGAGGCAGCTAGG - Intergenic
1172221263 20:33276644-33276666 CTGAAGCTCAGGAGGGAGCTGGG - Intronic
1172872935 20:38147077-38147099 CCGGGGGACAGGAGGGAGATGGG + Intronic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173249788 20:41358389-41358411 ATGGAGGCCTGCAGGCAGCTGGG - Intronic
1173584878 20:44174946-44174968 CTGGAGTGCAGGAGGGATCTTGG - Intronic
1173860691 20:46281328-46281350 CTGGGGGACTGGAGGAGGCCAGG + Intronic
1174203239 20:48821526-48821548 CTAGAATACTGGAGGGAGGTGGG - Intronic
1174436533 20:50510804-50510826 CTGGAGAACAGAAGGGAGGTGGG - Intronic
1174534041 20:51237134-51237156 CTGGAGGAGCTGGGGGAGCTCGG + Intergenic
1175390128 20:58621872-58621894 CTGGTGGACTGGGGGAAGATGGG - Intergenic
1175401507 20:58702060-58702082 CAGGAGGTCTGGAAGGAGCAGGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1175919097 20:62441732-62441754 CTGGAGGAGAGGAGGGGCCTGGG - Intergenic
1175930595 20:62492072-62492094 CTGGAGGCCTGCAGGGAGAGTGG + Intergenic
1176666865 21:9695862-9695884 CAGGAGGCCTGGACAGAGCTTGG + Intergenic
1176673921 21:9759203-9759225 CAGGAGCACCGGAGGGAGCCTGG - Intergenic
1179407254 21:41136355-41136377 CTGCAGGGCTGGTGGGAGCCAGG + Intergenic
1179580867 21:42343324-42343346 CTGGAGGAGCGCAGGGAGCCAGG + Intergenic
1179626506 21:42652568-42652590 CTGGAGCTCTGGTGGCAGCTGGG - Intergenic
1179818697 21:43923891-43923913 CTGGAGGACGGCAGGGGGCTGGG + Intronic
1180087184 21:45513027-45513049 TTGGAGGACAGGCCGGAGCTGGG - Exonic
1180695162 22:17747222-17747244 CTGCAGGACAGGAGTGGGCTCGG + Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181485105 22:23225564-23225586 CTGTAGGTCTGGAGGTGGCTGGG + Intronic
1181937764 22:26450837-26450859 CTGCAGGGCTGGAGAGACCTTGG - Intronic
1182287233 22:29255610-29255632 CTTGAGGAGTGTAGGGTGCTGGG + Intronic
1182353486 22:29711534-29711556 GTGGGGGACAGGTGGGAGCTGGG + Intergenic
1183323146 22:37177309-37177331 CTGGAGGACTGGAGGGTGCTGGG - Intergenic
1183355405 22:37356202-37356224 CTGAAGGACTAGAGGCTGCTGGG + Intergenic
1183355846 22:37358965-37358987 CAGGAGGACTGGGGGCCGCTGGG + Intergenic
1183714832 22:39527544-39527566 CTGGAAGGCAGCAGGGAGCTGGG - Intergenic
1183977297 22:41519977-41519999 TTGCAGGGCTGGAGGGAGCCCGG + Intronic
1184607872 22:45584703-45584725 ATGGAGGGCTGGTGGGAGCCCGG + Intronic
1184762256 22:46551312-46551334 GTGGAGGAGGGGAGGGATCTGGG - Intergenic
1184784109 22:46663518-46663540 CTGGGGGTCCCGAGGGAGCTAGG + Intronic
1184869071 22:47222121-47222143 GTGGAGGAGGGGAAGGAGCTAGG - Intergenic
1185095345 22:48803360-48803382 TTGGATGCCTGGAGGGAGCCGGG - Intronic
1185280050 22:49966153-49966175 CTGGGGGGCTGGAGGGGGCCAGG - Intergenic
949511222 3:4768779-4768801 GTGGGGGCGTGGAGGGAGCTCGG + Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
950773796 3:15332709-15332731 TTGGAGATGTGGAGGGAGCTGGG - Intronic
953958417 3:47248382-47248404 CTGGTAGACTGGAAGGAGCCTGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
955055029 3:55447158-55447180 CAGGGGGACGCGAGGGAGCTGGG - Intergenic
955656144 3:61247008-61247030 ATGGAGGACAGGAGGGAGGGAGG - Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957084175 3:75665005-75665027 CTGGAGAACAGAAGAGAGCTGGG + Intronic
958966205 3:100561708-100561730 GAGGATGACTGGAGGGAGCTTGG - Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960619077 3:119621894-119621916 CTGGAGGCCCCAAGGGAGCTAGG - Intronic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
961314213 3:126023420-126023442 AGGGAGGGCAGGAGGGAGCTGGG + Intronic
961350079 3:126294403-126294425 CCAGAGGACTGCAGGGAGCACGG - Intergenic
962393494 3:134993471-134993493 ATCGGGGACTGGAGAGAGCTTGG + Intronic
962803829 3:138913169-138913191 AGGGAGGACTGGAGGGGACTTGG - Intergenic
964719582 3:159757798-159757820 CAGGAGGCATGGAGGTAGCTTGG - Intronic
966366639 3:179195113-179195135 CTGGGGAACTGGAAGCAGCTGGG + Intronic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
967806183 3:193716411-193716433 TTGGTGAACTGGAGGGAGCCAGG - Intergenic
968471250 4:783423-783445 CTGGATGCCAGGTGGGAGCTGGG - Intergenic
969244963 4:5925868-5925890 CTTAAGGACTGGAGAGGGCTGGG + Intronic
969363927 4:6683011-6683033 GTGGAGGACTGGAGGGGTCAGGG - Intergenic
969643677 4:8413621-8413643 GTGGAGGGGTGGAGGGAGATGGG - Intronic
969756448 4:9153248-9153270 CTGGAGACCTGGAGGAAGCCGGG - Intergenic
969882994 4:10190927-10190949 CTGGAGGACTGTATGATGCTTGG + Intergenic
970565969 4:17333080-17333102 TGGGAGTACTGGTGGGAGCTTGG + Intergenic
970694451 4:18660914-18660936 CTTGAGAACTGGAGGAAGGTGGG + Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972312787 4:37896320-37896342 GTGAAGGAGTGGAGGGGGCTGGG + Intronic
975832685 4:78386513-78386535 CAGGAGGCCAGGAGGGTGCTTGG + Intronic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
978413378 4:108449518-108449540 CTGTAATACTGGAGAGAGCTTGG + Intergenic
980589753 4:134870355-134870377 CTGGAGGATTGGATGAATCTGGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
984805312 4:183746530-183746552 CTGCAGGGCGGGAGCGAGCTCGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985408144 4:189656486-189656508 CAGGAGGCCTGGACGGAGCTTGG - Intergenic
985446813 4:190026560-190026582 CTGGAGAACAGAAGAGAGCTGGG - Intronic
985805799 5:2042206-2042228 CTGGGGGACTGGCCGCAGCTGGG + Intergenic
985925576 5:3013770-3013792 CTTGAGGACTGCAGGGTGATGGG + Intergenic
986293966 5:6422244-6422266 CTGGAGCTTTGGAGGGAGCGTGG + Intergenic
986763536 5:10901836-10901858 CTGGAGAAGTGGAGGTGGCTAGG + Intergenic
992678245 5:79127199-79127221 CTGAAGGCCTGTTGGGAGCTGGG + Intronic
994525738 5:100903114-100903136 TTCGAGGACCAGAGGGAGCTCGG - Exonic
995210337 5:109530608-109530630 GTGGAGGGCTGGAGGAAGCTTGG - Intergenic
995853879 5:116573731-116573753 CTCGAGGGCTGGAGGGGGTTGGG - Intronic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
999127414 5:149256110-149256132 CTTGAGAACTGGAGGGAGAAAGG + Intronic
1001562403 5:172678091-172678113 CAGGAGGAACGGCGGGAGCTCGG - Intronic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1002430676 5:179202226-179202248 CTGGAAGAATGGAGGCAGCCTGG - Intronic
1002434591 5:179222855-179222877 CTGGAGGTTCGGAGGCAGCTGGG - Intronic
1003311309 6:4971999-4972021 CTGCAGGCCTGGAGGGAGTGGGG + Intergenic
1004029494 6:11852449-11852471 GTGGAGGAGAGGAGGGAGCAGGG + Intergenic
1004221799 6:13753704-13753726 CTGTAGGCCTGGAGGTACCTGGG + Intergenic
1004883125 6:20028162-20028184 CTGGAGGACTGGCAGCAGATGGG - Intergenic
1005160126 6:22850089-22850111 CCTGAGAACTGGAGGGAGTTGGG + Intergenic
1006408387 6:33857983-33858005 CTGGAGCACTGGTGGGCACTGGG + Intergenic
1006735222 6:36268554-36268576 CTGCGGGACTGGAGGCAGCTGGG - Intronic
1006750441 6:36373457-36373479 CGGGGGGACTGGAGAGTGCTGGG + Exonic
1006863238 6:37187547-37187569 CTGGAGCTCAGGAGCGAGCTCGG - Intergenic
1007746183 6:44044155-44044177 CTGGAGGCCTGGAGGGGCCATGG - Intergenic
1010021395 6:71163858-71163880 CTGGAGGAATGGAGTGAGTATGG - Intergenic
1013016285 6:106163501-106163523 CTGGAGGAAAGGAGTGAGCCAGG - Intergenic
1013155726 6:107490032-107490054 CGGGAGGAGGGGAGGGAGCGCGG - Exonic
1013314551 6:108929124-108929146 CTGGAGGGAAGGAGGGGGCTGGG - Intronic
1013366873 6:109443552-109443574 AAGGAGGCCTGGACGGAGCTGGG + Exonic
1015279095 6:131413352-131413374 ATAAAGGACTAGAGGGAGCTGGG + Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017215587 6:151902208-151902230 CTTGAGGAATGGAGGAAGTTTGG - Intronic
1017728354 6:157291989-157292011 GTGGAAGACAGGAGGGAGTTGGG + Exonic
1018306939 6:162467772-162467794 CTGGAGGACAAGTGGGAGCCAGG - Intronic
1018370229 6:163161667-163161689 CTGGAGGATTGGAGGGGGTCAGG - Intronic
1018429622 6:163713099-163713121 CTGGGGGCCTGCAGGGAGCCAGG + Intergenic
1019155004 6:170032797-170032819 ATGGAGAACTGGAGGGTGCCAGG - Intergenic
1019578305 7:1748198-1748220 CGGGAGGACGGGCGGGAGCAGGG + Intergenic
1019644324 7:2120998-2121020 CAGGTGGACTCGAGGGAGATGGG + Intronic
1021578646 7:22129050-22129072 CTGGATTACTGGAGAGAGCAGGG + Intronic
1022590313 7:31655079-31655101 CTGGGATACTGGAGAGAGCTGGG - Intronic
1022649121 7:32258838-32258860 TTGCAGGCCTGGAAGGAGCTGGG - Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023207829 7:37770203-37770225 CTGATGGACTGTGGGGAGCTGGG - Intronic
1023756546 7:43423613-43423635 ATGGAGGAATAGAGTGAGCTGGG + Intronic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1023873425 7:44274718-44274740 CGGGTGGCCTGGAGGGAGCAAGG + Intronic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024095519 7:45979567-45979589 CTGGAGGTCAGGAAGGAGCTAGG + Intergenic
1024508603 7:50184723-50184745 CTGGAGGACTGCATGAAGCAAGG - Intergenic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1026170000 7:67945614-67945636 CCAGAGCACTGGAAGGAGCTCGG - Intergenic
1026509357 7:71015680-71015702 AAGGAGGACTGGAGTGAGTTCGG + Intergenic
1026872785 7:73863305-73863327 CTGCAGGACTGGGGTGAGGTGGG - Intronic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028733275 7:94178033-94178055 ATGAAGGACAGGAGAGAGCTTGG + Intergenic
1028840977 7:95429913-95429935 CTAGAAGACTGTGGGGAGCTGGG + Intronic
1029702402 7:102256057-102256079 CTGGGAGACTGGAGGGAGTCGGG - Exonic
1030695541 7:112580989-112581011 GTAGAGGACTGGATGGAGCTAGG + Intergenic
1032429638 7:131850148-131850170 GTGGAGGAGAGGAGAGAGCTTGG + Intergenic
1032809400 7:135395678-135395700 CTGGATGTCTGTGGGGAGCTGGG + Exonic
1033007122 7:137578403-137578425 CTGTAGGATAGGAGGGAGCTGGG - Intronic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034321621 7:150189025-150189047 CTGGGGTGTTGGAGGGAGCTTGG - Intergenic
1034771126 7:153778257-153778279 CTGGGGTGTTGGAGGGAGCTTGG + Intergenic
1035026648 7:155830881-155830903 GTGGAGGACCTGAGAGAGCTGGG + Intergenic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036740464 8:11356751-11356773 CTAGTGGACAGGAGGGTGCTGGG + Intergenic
1036778298 8:11628570-11628592 CTGGAGGAATGGAGGAGGCCCGG + Intergenic
1037088622 8:14884831-14884853 CTGGAGGATTGAAAGGAGATGGG - Intronic
1037562084 8:20084227-20084249 CAGGAGGAGTTGGGGGAGCTGGG - Intergenic
1037638175 8:20719361-20719383 CTCGAGGACTAGAGGGAGTTGGG + Intergenic
1037761889 8:21747043-21747065 CTGGAGGACTGCAGGGGGCCTGG - Intronic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1038519414 8:28217017-28217039 CTGGAGGAATGGAAGCAGATGGG + Intergenic
1039890525 8:41682643-41682665 CTCAAGGCCTGGTGGGAGCTAGG + Intronic
1040435513 8:47387239-47387261 ATGGAGGCCTGGTGGGAGCAGGG + Intronic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1041758666 8:61340336-61340358 CTGGAGGACTGGGGAGATGTTGG - Intronic
1041830721 8:62150040-62150062 CTGGAAGACTGGCTGCAGCTGGG + Intergenic
1044366127 8:91348002-91348024 CTGGTGCTCTGCAGGGAGCTCGG + Intronic
1045496998 8:102717399-102717421 CTGGAGGACTGGGAGTGGCTGGG + Intergenic
1045721024 8:105111167-105111189 CTAGAGGACTGAAGTGGGCTGGG + Intronic
1045976133 8:108132025-108132047 CGGGAGGACTCGCGGGAGCAGGG + Intergenic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1047501777 8:125447125-125447147 CAGGAGGGTGGGAGGGAGCTTGG - Intergenic
1047813049 8:128431058-128431080 CTGGAAGGCTGGAGTCAGCTGGG - Intergenic
1048443031 8:134473941-134473963 ATGGAGGAGGGGAGGCAGCTGGG + Intergenic
1049403965 8:142443401-142443423 CTGCAGCACTGGAGGCAGGTGGG + Intergenic
1049436252 8:142587497-142587519 CTGCAGAACGGGAGGGAGTTGGG + Intergenic
1049467515 8:142758646-142758668 CAGGAGTGCTGGAGGGAGCTGGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493006 8:142914966-142914988 ATGGAGGACTGAAGGGAGTGTGG - Intronic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049503561 8:142982265-142982287 CTGGAAGGCTGGATGGAGCCAGG + Intergenic
1049573481 8:143380154-143380176 CTGGAGGAGCGCAGGCAGCTTGG + Exonic
1050009793 9:1173611-1173633 CTGGAGGTCTGGAAGGATCTAGG - Intergenic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1053103964 9:35394700-35394722 CAGGAGGAAAGGAGGGAGTTAGG + Intronic
1053244222 9:36521308-36521330 CTGGAGGACTGGAAAAAGATAGG - Intergenic
1053616741 9:39775222-39775244 CTTGAGGGCTGGAGGGAGTACGG - Intergenic
1054236776 9:62567161-62567183 CTTGAGGGCTGGAGGGAGTACGG + Intergenic
1054267427 9:62932216-62932238 CTTGAGGGCTGGAGGGAGTACGG + Intergenic
1054835605 9:69672389-69672411 CTGGAGGGCGGGAGGGAGGGTGG - Intergenic
1055518435 9:77056689-77056711 CTAGACGACTGGAGGCACCTGGG + Intergenic
1055931712 9:81566028-81566050 ATGGAGGACGGAAGGGTGCTGGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057501956 9:95603144-95603166 GTGGAGAACTGGAGGAAGCTGGG - Intergenic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1058533631 9:105932077-105932099 CTGGAGAAATGGGGGCAGCTAGG + Intergenic
1058746168 9:107992824-107992846 CTGGAGGCATGCAGGAAGCTTGG - Intergenic
1058890108 9:109354320-109354342 CAGGAGCACTGAAGGGGGCTTGG - Intergenic
1058999847 9:110337153-110337175 CTGGAGGAGGGGAGGGGGTTTGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059696319 9:116733409-116733431 TTGGAGGTCTGGAAGGGGCTCGG + Exonic
1060212343 9:121718225-121718247 TTGGAGGGCGTGAGGGAGCTGGG - Intronic
1060297800 9:122355102-122355124 CTCAGGCACTGGAGGGAGCTGGG - Intergenic
1060375008 9:123109652-123109674 CTGGAGGACTTGTGGCAGCAGGG + Intronic
1060558355 9:124521866-124521888 CTGGGGGCCCCGAGGGAGCTGGG + Exonic
1061054283 9:128214119-128214141 CTGGAGGATGGCAGTGAGCTTGG - Intronic
1061642461 9:131969957-131969979 CTGGAGGGCTGGGGGGGGGTGGG + Intronic
1062366466 9:136211776-136211798 CTGGAAGACTGGTGGGAGGTGGG - Intronic
1189773774 X:44451826-44451848 CCTGATGACTGGGGGGAGCTTGG - Intergenic
1190316605 X:49155999-49156021 CTTGAGGCCTGGAGAGTGCTGGG - Intergenic
1190731704 X:53230871-53230893 CTGGAGGGGTGGAGGGAGTGAGG + Intergenic
1190775358 X:53548167-53548189 CTGGAGGACTGTGAGGAGCATGG + Exonic
1191645419 X:63475425-63475447 CAGGAGGACTAGAGAGACCTCGG - Intergenic
1193678519 X:84486932-84486954 CAGGAGGACAGGAGAGAGATTGG - Intronic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1195298559 X:103504177-103504199 CTGGAGGAGTGGGGAGAGGTGGG + Intronic
1195658791 X:107358685-107358707 CTGGAAGACTGGAGGGACAGAGG + Intergenic
1196339974 X:114584486-114584508 GGAGAGGAATGGAGGGAGCTCGG - Exonic
1196890167 X:120283791-120283813 GTTGAGGAATGGAGGCAGCTAGG - Intronic
1198270373 X:135051401-135051423 CTGGAGGAGTGGAGGTGGGTTGG + Exonic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic