ID: 1175889611

View in Genome Browser
Species Human (GRCh38)
Location 20:62310434-62310456
Sequence CCCCGCTGCCTGGGAAGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175889605_1175889611 0 Left 1175889605 20:62310411-62310433 CCACAGACCTAAAGTGATAACTC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889604_1175889611 1 Left 1175889604 20:62310410-62310432 CCCACAGACCTAAAGTGATAACT 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889606_1175889611 -7 Left 1175889606 20:62310418-62310440 CCTAAAGTGATAACTCCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889603_1175889611 7 Left 1175889603 20:62310404-62310426 CCAGCACCCACAGACCTAAAGTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889602_1175889611 16 Left 1175889602 20:62310395-62310417 CCTGGGATGCCAGCACCCACAGA 0: 1
1: 0
2: 2
3: 29
4: 355
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889601_1175889611 26 Left 1175889601 20:62310385-62310407 CCTGCTGAGGCCTGGGATGCCAG 0: 1
1: 1
2: 4
3: 32
4: 370
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214
1175889600_1175889611 27 Left 1175889600 20:62310384-62310406 CCCTGCTGAGGCCTGGGATGCCA 0: 1
1: 0
2: 4
3: 39
4: 316
Right 1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175889611 Original CRISPR CCCCGCTGCCTGGGAAGAAC AGG Exonic
900931956 1:5743335-5743357 CACTGCTTCCTGGGAAGGACAGG + Intergenic
901197518 1:7448382-7448404 ACCCTCTGCCTGGGGAGAACTGG + Intronic
901918051 1:12515430-12515452 CCCAGCTCCATGGGAAGAAGAGG - Intergenic
903320736 1:22541661-22541683 CCCCACAGCCTGGGCAGAGCTGG + Intergenic
903779021 1:25810001-25810023 CACGGGTGCCTGGGAAGAGCTGG - Intronic
904580952 1:31544011-31544033 CCCCACTGCCTGGGCACAAGTGG - Intergenic
907368590 1:53982486-53982508 CCCTCCTGCCTGGAAAAAACTGG + Intergenic
915328996 1:155097647-155097669 CACAGCTGCCTGGGAGGAAGAGG + Intergenic
917336848 1:173932547-173932569 CCCTGCTTCCTGGGAATAAAAGG - Exonic
917421373 1:174867263-174867285 CCCAGCTGCTTGGGAAGATGAGG + Intronic
918248822 1:182684129-182684151 ACCTGCTAACTGGGAAGAACAGG + Intronic
921300219 1:213744880-213744902 CTCAGCTGCCTGGGGGGAACAGG + Intergenic
922488488 1:225996105-225996127 CCCAGATGCCAGGGCAGAACAGG + Intronic
923043352 1:230336123-230336145 CCCAGCTGCTTTGGAAGAATGGG - Intronic
924383269 1:243482531-243482553 CACCCCTGCCTGGGTAGGACTGG - Intronic
1063365439 10:5487597-5487619 CCGCGCTGCCTGGGAGGTAAGGG - Intergenic
1065528520 10:26646091-26646113 CCAAGCTGCCTGAGAAGAGCAGG + Intergenic
1065558495 10:26939646-26939668 CCAAGCTGCCTGAGAAGAGCAGG - Intergenic
1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG + Intergenic
1066628262 10:37431945-37431967 CCCCGTAGCATGGGAAGAAATGG + Intergenic
1068910395 10:62373877-62373899 CCCTGCTGCTTGGGATGAAGAGG + Intergenic
1069265547 10:66453099-66453121 CCCAGCTGCTTGGGAAGTATAGG + Intronic
1071905101 10:90164162-90164184 CCTCTCTGCCTTGGAAGAACTGG - Intergenic
1072387588 10:94946997-94947019 CCCAGCTACCTGGGAAGCTCAGG + Intronic
1072523876 10:96254415-96254437 CCAGGCTGCCTGGGAAGAGAAGG - Intronic
1076343467 10:129765420-129765442 CCCCTCTGCCTGGGCAGACAGGG - Intronic
1076553464 10:131304435-131304457 CCCTTCTTCCTGGGAAGAAGAGG + Intronic
1076594569 10:131617771-131617793 CCTCCCTGCCTCGGAAGAGCAGG - Intergenic
1076992507 11:282814-282836 GCCCGCTCCGTGGGAAGAGCTGG - Intronic
1077298722 11:1837711-1837733 CCGGGCCGCCTGGGAAGACCGGG + Intergenic
1077994468 11:7441584-7441606 CCCAATAGCCTGGGAAGAACTGG - Intronic
1078171048 11:8929459-8929481 CCTGGCTGGCTGGGAAGAGCTGG - Exonic
1082174816 11:49048274-49048296 GCCCGCTGCTTTGGAAGAAGAGG - Intergenic
1083333526 11:61910191-61910213 CCCCGCTGCAGGGGAAGGGCAGG + Intronic
1084364601 11:68689510-68689532 CCCAGCTACCTGGGAAGAAGAGG - Intronic
1084553016 11:69859953-69859975 CCCTGCTGCATGGGAAGAAATGG - Intergenic
1086015896 11:82167148-82167170 CCCTGCTGCTTGGGCAGTACTGG - Intergenic
1086690956 11:89787812-89787834 GCCCGCTGCCCTGGAAGAAGAGG + Intergenic
1086714846 11:90051843-90051865 GCCCGCTGCCCTGGAAGAAGAGG - Intergenic
1088212976 11:107476439-107476461 TCCCACTGAGTGGGAAGAACAGG - Intergenic
1089771956 11:120809312-120809334 CTCTGCTGCCTGGGAGGAAGAGG + Intronic
1091643339 12:2254228-2254250 CCCCACTCCCTGAGAACAACTGG - Intronic
1091842959 12:3633613-3633635 CCGCCATGCCTGGGGAGAACCGG + Exonic
1092333502 12:7607198-7607220 ACTCAGTGCCTGGGAAGAACTGG - Intergenic
1095171574 12:39042344-39042366 CCCAGCTACCTGGGAAGCTCAGG + Intergenic
1096350741 12:50898226-50898248 CCCAGCTGCCTGGGATGCAGAGG + Intergenic
1096572591 12:52532423-52532445 CCGAGCTCCCTGGGAAGAAAGGG - Intergenic
1096782918 12:54001152-54001174 CCACGCTGACTGGGAAGCAGGGG - Intronic
1097711443 12:62921668-62921690 CCCTGCTGCCTGGGAGGTTCAGG + Intronic
1099445776 12:82749851-82749873 CCCAGCTACCTGGGAAGCAGAGG - Intronic
1100904321 12:99279886-99279908 CCCAGCTACCTGGGAAGATGAGG + Intronic
1102953493 12:117045288-117045310 CCCCGCAGCCTGGGAAGCAGAGG - Intronic
1103085732 12:118060968-118060990 CCCCCCTCCCCGGGGAGAACGGG + Intronic
1103212514 12:119177181-119177203 TCCAGCTGCATGGGAAGAGCAGG + Intergenic
1103351034 12:120283706-120283728 CACCTCAGCCTGGGAAGTACTGG - Intergenic
1105241201 13:18610638-18610660 CTCCTCTGCCTCGGAAGCACCGG - Intergenic
1106457820 13:29943014-29943036 CCCAGCTTCCTGGGAAGATGGGG + Intergenic
1106628783 13:31447964-31447986 CCTCCCTGCCCAGGAAGAACTGG + Intergenic
1112581708 13:100681874-100681896 CCCCGCTGCTGGAGAAAAACAGG - Intergenic
1114346846 14:21805520-21805542 CCCAGCTGCTTGGGAAGCTCAGG + Intergenic
1114487531 14:23071769-23071791 CCCTGCCCCCTGGGAAGACCAGG - Intronic
1114562538 14:23603649-23603671 CCCAGTGGCCTGTGAAGAACTGG - Intergenic
1118633782 14:67729177-67729199 CCCCGGTGCCTGGGACAAAGAGG - Exonic
1118806175 14:69238875-69238897 TCCACCTGCCTTGGAAGAACTGG + Intronic
1119314763 14:73683821-73683843 CCCAGCTACCTGGGAGGAAGAGG - Intronic
1119643812 14:76334459-76334481 CACAGCCGCCTGGGAAGCACAGG + Intronic
1119971039 14:78970939-78970961 CCCCGCTGGGTGGGATGAAGTGG + Intronic
1121895148 14:97639865-97639887 CCCCGCTGCCTGGGATCTGCAGG + Intergenic
1122066428 14:99176801-99176823 CCCCCCTCCCTGGGAAGATTCGG - Intronic
1122902476 14:104787520-104787542 CCCCTCTGCCTGGGCACACCCGG - Intronic
1202849625 14_GL000225v1_random:8745-8767 CATCGCTGCCAGGGAAGAGCTGG + Intergenic
1202854684 14_GL000225v1_random:43161-43183 GCCCGCCGCCAGGGAAGAGCTGG + Intergenic
1202857096 14_GL000225v1_random:58452-58474 TCCCGCCGCCAGGGAAGAGCTGG + Intergenic
1123490153 15:20774509-20774531 CTCCTCTGCCTCGGAAGCACCGG + Intergenic
1123546654 15:21343596-21343618 CTCCTCTGCCTCGGAAGCACCGG + Intergenic
1125512323 15:40298741-40298763 CCCCGCTGCCAAGGCAGGACAGG + Intronic
1127439327 15:58990532-58990554 CCCAGCTGCCTGGGAAGCTGAGG + Intronic
1129111145 15:73338023-73338045 CTGAGCTGCCTGGGAAGAGCTGG + Intronic
1129169617 15:73799596-73799618 TCCCGCTGGGTGGGAAGAGCAGG + Intergenic
1129346035 15:74919865-74919887 CACCACTGCAAGGGAAGAACAGG + Exonic
1202954985 15_KI270727v1_random:70811-70833 CTCCTCTGCCTCGGAAGCACCGG + Intergenic
1132871123 16:2116185-2116207 CCCCTCTTCCTGGGAAGTTCGGG - Intronic
1132950275 16:2557890-2557912 CGCCGCAGCCTCGGAAGAAGCGG + Exonic
1132964071 16:2642280-2642302 CGCCGCAGCCTCGGAAGAAGCGG - Intergenic
1134079767 16:11316635-11316657 CCTCACCGCCTGGGAACAACAGG + Intronic
1134521410 16:14920709-14920731 CCCCTCTTCCTGGGAAGTTCGGG + Intronic
1134958460 16:18392770-18392792 CCCCTCTTCCTGGGAAGTTCGGG - Intergenic
1136235039 16:28908542-28908564 CTGCCCTGCCTGGGAAGAAGGGG + Intronic
1141142440 16:81505441-81505463 CCCCGCTGCCTTTGAAAACCAGG - Intronic
1141773939 16:86109845-86109867 TGCCGCTGCCTGGGAACACCTGG + Intergenic
1141802193 16:86317639-86317661 CGCCTCTGCCTGGGAGGATCGGG + Intergenic
1142121791 16:88390157-88390179 CCCCTCTGCCTGGAGAGCACAGG - Intergenic
1142550893 17:738686-738708 CCCAGCTTCCTGGGAAGCAGAGG - Intronic
1143416875 17:6756796-6756818 GCCCGCTGCCTGGGCAGAAGAGG + Intronic
1144532969 17:16057961-16057983 TCCCTCTGCCTGTGAAGAAGGGG + Exonic
1145081911 17:19901184-19901206 CCCCTCTGCTTGGGCAGGACTGG - Intergenic
1145183500 17:20773701-20773723 AACCGCTGCCTGGGAAGCAGAGG + Intergenic
1146036706 17:29413478-29413500 CCCAGCTGCTTGGGAAGCAGAGG + Intronic
1147138432 17:38448162-38448184 CCTCCCTGCTTGGGAGGAACTGG + Intronic
1147142371 17:38466759-38466781 CCCCAGTGCCTCGGCAGAACGGG - Exonic
1148581857 17:48749825-48749847 CCCCTCTGCTTGGGAGGAAGGGG - Intergenic
1150147466 17:62780991-62781013 CGCCGGTGCCTGGGAAGGAGGGG + Intronic
1152610273 17:81311914-81311936 CCCCGCTCCTGGGGAAAAACAGG + Exonic
1152617508 17:81344842-81344864 CCCCCCTTCCTAGGAAGGACAGG - Intergenic
1153044167 18:840526-840548 CCCAGCAGCCTGAGATGAACTGG + Intergenic
1154447756 18:14449263-14449285 CTCCTCTGCCTCGGAAGCACCGG + Intergenic
1156558380 18:38092991-38093013 CCCAGCTACCTGGGAAGATGAGG + Intergenic
1156913339 18:42437330-42437352 CCCTGCAGCCTAGGAAGAACAGG + Intergenic
1158545444 18:58392330-58392352 CCCCGCTGCATGAGAAACACAGG - Intronic
1160318518 18:77869267-77869289 GCCCACTGCCTGGAAGGAACAGG + Intergenic
1160848967 19:1180597-1180619 CCCCTCTGCCTGGGAACACAGGG - Intronic
1161088262 19:2344848-2344870 CCCCGCTCCCTAGGAACAAAGGG - Intronic
1161340864 19:3741352-3741374 CCCCGCTGCTTGGGAAGCTGAGG + Intronic
1161377981 19:3950003-3950025 CCTCCCTGCCTGGGAGGCACTGG + Intergenic
1161534034 19:4807791-4807813 CCCCGCTACCTGGGAAGCTGAGG + Intergenic
1164611586 19:29636266-29636288 CCCAGCTGCCTGGCAAGGCCGGG - Intergenic
1164684184 19:30156300-30156322 CCCAGTTGCCTGGGAACCACTGG - Intergenic
1165193472 19:34082520-34082542 CCCCGCTGGTAGGGAAGACCTGG - Intergenic
1166676262 19:44742840-44742862 CCCTTCTCCCTGGGAAGAAATGG - Intergenic
1167714912 19:51137063-51137085 TCCCTCGGCGTGGGAAGAACTGG - Intergenic
1168145972 19:54420395-54420417 CCCCGCAGCCTGGGAACAAGAGG + Intronic
1168425831 19:56237799-56237821 CCCAGCTGCTTGGGAGGAAGAGG + Intronic
1168530468 19:57124229-57124251 CCTCACTGCCTGGGGAGAAATGG + Intronic
925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG + Intergenic
925590735 2:5507217-5507239 CCCAGCTGCTAGGGAGGAACGGG - Intergenic
926341563 2:11908805-11908827 TCCCTCTGCCTGGGAAGGATGGG + Intergenic
927667291 2:25041765-25041787 CCACGCAGCCTGGACAGAACTGG + Intergenic
927718000 2:25364838-25364860 CCCAGCTGCCTGGGAAAGACTGG - Intergenic
928013889 2:27636098-27636120 CCCCGCTACCTGGGAGGCAGAGG + Intronic
934105546 2:88691745-88691767 CCCCGCTGCCCGGGAGGGCCGGG + Exonic
934116915 2:88807453-88807475 CACCCCTGCCTGGGAACTACCGG + Intergenic
936042209 2:109158583-109158605 CCTCGCTGCCTGGGATGATAAGG + Intronic
937256608 2:120560494-120560516 CCCCGCATCCTGGGTAGCACTGG + Intergenic
938384436 2:130854362-130854384 CCCCGCTTCCTAGGAAGAGGTGG - Intronic
941358434 2:164521211-164521233 CCCAGCTGCCTGGATGGAACTGG + Intronic
942248476 2:174028020-174028042 CCCCTCTGCCTGGCAAGAAATGG + Intergenic
942607961 2:177711870-177711892 CCCAGCAGTCTGGGAAGAAGGGG + Exonic
943165461 2:184318036-184318058 CCCAGCTGCTTGGGAAGATGAGG - Intergenic
945009098 2:205442586-205442608 CCGCCGGGCCTGGGAAGAACGGG + Intronic
949013657 2:241696964-241696986 CCCAGCTGCTTGGGAGGAAGAGG + Intergenic
949050615 2:241895635-241895657 CCTCGTGGCCTGGGGAGAACCGG + Intronic
1168890864 20:1294721-1294743 CGCCGCTGGCTGGGATGACCAGG + Intronic
1170047232 20:12098234-12098256 CTCCGTTGCCTGGGACGAGCTGG - Intergenic
1171425108 20:25044057-25044079 CCCTGCTGGCTGAGAAGATCTGG + Intronic
1172195678 20:33089868-33089890 CACAGCTGCCAGGGCAGAACCGG - Intronic
1172785333 20:37464775-37464797 CCCCGCTGCTCGGGAGGATCTGG + Intergenic
1173342412 20:42164227-42164249 ACCAGCTGCCTGGGAAAGACAGG + Intronic
1175577779 20:60075499-60075521 CACCTCAGCCTGGGAAGAGCTGG - Intergenic
1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG + Exonic
1178893794 21:36542624-36542646 CGCGGCTCCCTGGGGAGAACGGG - Intronic
1179710018 21:43208013-43208035 TCCCCCTGCCTGGGAGGAACAGG + Intergenic
1179710036 21:43208071-43208093 TCCCTCTGCCTGGGAGGACCAGG + Intergenic
1180831449 22:18908967-18908989 GCCGGCTGCCTGGGCAGAAGGGG - Intronic
1182357971 22:29730752-29730774 GCCCGTTGCCTGGTAAGAAGTGG - Exonic
1183293924 22:37019130-37019152 CCCCTCTGCCTTGGAAGGAAAGG - Exonic
1183780570 22:39996079-39996101 CCCAGCTGCCTGGAATGAATGGG + Intronic
1183937582 22:41272209-41272231 CCCCGAGACCTGTGAAGAACAGG - Intronic
1184986844 22:48141620-48141642 CCACGGTGCCTGGGAAGACCAGG + Intergenic
1185220592 22:49627418-49627440 CCTACCTGCCTGGGAAAAACTGG - Intronic
1203281533 22_KI270734v1_random:134238-134260 GCCGGCTGCCTGGGCAGAAGGGG - Intergenic
950643144 3:14361179-14361201 CCCAGCTGCCTGGGGAGCAGTGG + Intergenic
950691272 3:14659996-14660018 CCCTGCTGTCTGGGAAGAAGCGG - Intronic
952830716 3:37562469-37562491 CCCCGCTGCCCCGAAAGATCAGG + Intronic
956677370 3:71748641-71748663 CCACGATGGCTTGGAAGAACAGG + Intronic
959993257 3:112652379-112652401 CCCAGCTACCTGGGAAGACGAGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
965249788 3:166327998-166328020 CCCAGATGCCTTGGAAGAAAAGG - Intergenic
965440688 3:168709802-168709824 ACCCCCTGACTGGAAAGAACTGG + Intergenic
968781870 4:2588492-2588514 CCCTGCTGCCAGGGGAGCACAGG + Intronic
969297894 4:6280325-6280347 CACAGCTGCCTGTGAAGAAACGG - Intronic
969355077 4:6620461-6620483 GCCCTCTGCCTGGGACGCACAGG + Intronic
969537607 4:7766349-7766371 CCCCACTGCCTGGGAGGAAATGG - Intronic
974162361 4:58156354-58156376 CCCAGCTACCTGGGAAGCTCAGG - Intergenic
977554387 4:98473873-98473895 CCCAGCTGCTTGGGAAGCAGAGG - Intronic
985099907 4:186448611-186448633 TCTGGCTGCCTGGGAAAAACAGG - Intronic
985610257 5:883937-883959 CCTTGCCGCCTGGGAGGAACCGG + Exonic
985663931 5:1172102-1172124 CCCAGCAGCCTGGGGAGATCAGG + Intergenic
992555785 5:77901748-77901770 CCCCTCAGCCATGGAAGAACAGG - Intergenic
993669601 5:90744102-90744124 CCCAGCTGCCTGGGAAGCTGAGG - Intronic
996535717 5:124575259-124575281 CCCGGCTGTCTGTGAAGAAATGG - Intergenic
998165088 5:139838257-139838279 CCCCGCTGCCTGCCCAGCACTGG - Intronic
1003080183 6:3015413-3015435 CCCAGCTGCCAGGGAAGAGGAGG + Intronic
1003125341 6:3351486-3351508 CCCCGCTGCCTGGCACGCTCAGG - Intronic
1004412394 6:15392798-15392820 CCCCGCTACCTGGGAGGATGAGG - Intronic
1004680626 6:17890740-17890762 CCCAGCTGCCTGGGAAGCTGAGG - Intronic
1004690522 6:17988379-17988401 CCTCGCTGCCAGGGCGGAACTGG + Intergenic
1005914700 6:30342181-30342203 CCCGGATGCCTGGGTAGAAGAGG - Exonic
1006389750 6:33751418-33751440 CCCCACTGACTGGGAAGCAAGGG + Intergenic
1006537662 6:34712934-34712956 CCCCGCTACTTGGGAAGCAGAGG + Intergenic
1006583993 6:35093729-35093751 GTCCTCTGGCTGGGAAGAACAGG - Intergenic
1007414314 6:41683199-41683221 CCCCGGTGCCTGGCGGGAACAGG - Intergenic
1011659429 6:89581630-89581652 CCCAGCTGCCTGGGAATCAAAGG + Intronic
1019191375 6:170253021-170253043 CACGGCTGCCAGGGAAGAGCTGG - Intergenic
1019485935 7:1289196-1289218 CCCCGCAGCCCCGGAAGATCTGG + Intergenic
1020918774 7:14234035-14234057 CCCCCTTGCCTGGCAAGTACAGG + Intronic
1021130195 7:16902377-16902399 CCACTCTGCCTGAGAAGAATAGG + Intergenic
1022440361 7:30427975-30427997 CCCAGCAGCCTGGGAAGCACTGG - Intronic
1024299654 7:47877204-47877226 CCCTGCAGCCTGGTTAGAACAGG - Intronic
1024930109 7:54660380-54660402 CCCAGCAGCCTGGGAAGCTCTGG - Intergenic
1026528653 7:71177539-71177561 CCCTTCTGCCTGGGGAGAAGGGG + Intronic
1032579137 7:133087828-133087850 CCCAGCAGCCTGGGCAGAGCCGG - Intergenic
1034193054 7:149225613-149225635 CCCCTCTGCCCTGGGAGAACTGG - Exonic
1035165945 7:156989979-156990001 CCCCGCTCACTGGGAAGCCCAGG - Intergenic
1035384151 7:158459249-158459271 CCCCACTGCCTGGGATGAATGGG + Intronic
1035384162 7:158459288-158459310 CCCCACTGCCTGGGATGAATGGG + Intronic
1035384198 7:158459432-158459454 AGCCCCTGCCTGGGACGAACGGG + Intronic
1039376485 8:37039629-37039651 ACACACTGCCTGGGAAGAAAAGG + Intergenic
1039912296 8:41834933-41834955 CCCCGCTGCCCGGGAGAAGCTGG + Intronic
1043735098 8:83731312-83731334 CCCCTCTGCCTGGGAAGGCTTGG - Intergenic
1046772151 8:118126893-118126915 CCCTGCTGCCTGGTGAGAAGCGG + Intergenic
1047476508 8:125237154-125237176 CCCTGCTGCCTGGGATCAAGAGG - Intronic
1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG + Intergenic
1049353646 8:142177318-142177340 CCCCTGGGCCTGGGGAGAACAGG + Intergenic
1049596412 8:143485901-143485923 CCCCCCAGCATGGCAAGAACAGG + Intronic
1049814486 8:144591802-144591824 CCTCCCTGCCTGGAAGGAACAGG + Intronic
1050090254 9:2011394-2011416 TTCCTCTGCCTGGGGAGAACAGG + Intergenic
1050575586 9:6991783-6991805 CCCAGCTGCCTGGGAAGCAGAGG + Intronic
1053016228 9:34663830-34663852 CCCAGCTTCCTGGAAAGGACTGG - Intronic
1054774530 9:69113971-69113993 CCCAGCTGCTTGGGAAGATGAGG - Intergenic
1055945256 9:81687710-81687732 CCCGGCGGCCAGGGAAGACCAGG + Intronic
1060238965 9:121886956-121886978 CTCAGCTGCGTGGGATGAACGGG + Intronic
1060787360 9:126461039-126461061 TCCCAAGGCCTGGGAAGAACAGG - Intronic
1061883665 9:133580112-133580134 CCCCGCCGCCCGGGAATACCTGG + Exonic
1062070686 9:134553571-134553593 CCCCGCTTCCTGGGAGGTCCGGG + Intergenic
1062404927 9:136391704-136391726 CACCGCTGCATGGGGAGACCTGG + Intronic
1203519777 Un_GL000213v1:34603-34625 CTGCGCTGCCTGGGAAGAAAGGG - Intergenic
1187506774 X:19885046-19885068 CCCAGCTACTTGGGAAGATCTGG + Intronic
1189141772 X:38614480-38614502 CCCTGGTGTATGGGAAGAACTGG - Intronic
1189179328 X:38988480-38988502 CCCCATTTCCTGGGAAGAATGGG + Intergenic
1189310331 X:40013723-40013745 CTCCGCTGCCAGGGGAGAACAGG + Intergenic
1190032079 X:46983561-46983583 CCTTTCTTCCTGGGAAGAACAGG - Intronic
1197759551 X:130018008-130018030 TCCCATTGCCTGGGAAGGACTGG - Intronic
1199976946 X:152899738-152899760 CACCCCTGGCTGGGAAGATCAGG + Intergenic
1200213033 X:154355311-154355333 CCCAGGTGCCTGGGAGGAAAAGG + Intronic
1201755318 Y:17480756-17480778 CCCTGCTGCCTGTGGAGAAACGG - Intergenic
1201846234 Y:18425229-18425251 CCCTGCTGCCTGTGGAGAAACGG + Intergenic