ID: 1175889642

View in Genome Browser
Species Human (GRCh38)
Location 20:62310515-62310537
Sequence GAGGCTGCACGGGAGGCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175889642_1175889649 19 Left 1175889642 20:62310515-62310537 CCAGGGGCCTCCCGTGCAGCCTC 0: 1
1: 0
2: 2
3: 44
4: 371
Right 1175889649 20:62310557-62310579 TGAACCCGACGGTCACCTATAGG 0: 1
1: 0
2: 0
3: 0
4: 16
1175889642_1175889652 29 Left 1175889642 20:62310515-62310537 CCAGGGGCCTCCCGTGCAGCCTC 0: 1
1: 0
2: 2
3: 44
4: 371
Right 1175889652 20:62310567-62310589 GGTCACCTATAGGAGCAGACCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1175889642_1175889653 30 Left 1175889642 20:62310515-62310537 CCAGGGGCCTCCCGTGCAGCCTC 0: 1
1: 0
2: 2
3: 44
4: 371
Right 1175889653 20:62310568-62310590 GTCACCTATAGGAGCAGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 62
1175889642_1175889647 8 Left 1175889642 20:62310515-62310537 CCAGGGGCCTCCCGTGCAGCCTC 0: 1
1: 0
2: 2
3: 44
4: 371
Right 1175889647 20:62310546-62310568 CACACAGCCGCTGAACCCGACGG 0: 1
1: 0
2: 1
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175889642 Original CRISPR GAGGCTGCACGGGAGGCCCC TGG (reversed) Exonic
900366842 1:2314975-2314997 GGGGCGGGACGGGAGGCCCTGGG + Intergenic
900478488 1:2887221-2887243 GAGGCAGCACCGGACGCCTCCGG + Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900659754 1:3776580-3776602 GCGGCTGCCAGGGAGGACCCGGG + Intergenic
901193322 1:7425497-7425519 GAGGCTGCTCTGAAGGACCCTGG - Intronic
901660768 1:10796491-10796513 GAGGCGCCCCGGGAGGCCCGCGG + Intronic
902534282 1:17110213-17110235 GAGGCTGCAGGGAGGGGCCCAGG + Intronic
902943145 1:19814805-19814827 CAGGCTGCAGATGAGGCCCCCGG + Exonic
902988030 1:20167416-20167438 GAGGCTGCACCCCAGGCTCCTGG - Intronic
903269456 1:22178419-22178441 GGGGCTGCACAGGAGGTCTCAGG - Intergenic
903424493 1:23243887-23243909 GGGGAGGCACGGGAGGCTCCTGG + Intergenic
903479922 1:23645543-23645565 GATGCTGCAGGGGAGGTTCCTGG + Intergenic
903839020 1:26225277-26225299 GCGGCTGCGCAGGAGGTCCCGGG - Intergenic
903952429 1:27004178-27004200 AATGCTGCAGAGGAGGCCCCAGG - Intergenic
904424489 1:30414732-30414754 GAGGCTGCAGGGTTGGCTCCAGG - Intergenic
904445587 1:30570918-30570940 GAGGCAGCAGGGGAGGTCCCAGG - Intergenic
905284347 1:36869616-36869638 CAGGCTGTAGGGGTGGCCCCAGG - Intronic
905393146 1:37650915-37650937 GAGCCTGCCTGGAAGGCCCCAGG + Intergenic
906065405 1:42976994-42977016 GAGGCTGCACGGGAGCACTGGGG + Intergenic
907459138 1:54594770-54594792 GAGGCAGGAAGGGAGGCTCCGGG + Intronic
908425607 1:64004182-64004204 GAGGAAGCAAGTGAGGCCCCTGG - Intronic
911142881 1:94524760-94524782 AAGGCTGGACAGGAGGCTCCTGG + Intergenic
912381426 1:109249953-109249975 CGGGGCGCACGGGAGGCCCCCGG + Intergenic
912795943 1:112693765-112693787 GCAGCTGCACTGGAGGCTCCGGG + Intronic
913318625 1:117573774-117573796 GAGTGTGCACGGGAATCCCCTGG + Intergenic
914902993 1:151721745-151721767 GAGGGCGCAGGGGAGACCCCCGG + Intronic
915281135 1:154822847-154822869 AAGGCTGCAGTGGAGGCCACGGG - Intronic
915486782 1:156226940-156226962 GAGGTTGCAGAGGAGGCTCCTGG + Intronic
915526948 1:156481725-156481747 GAGGGTGCCCGGGAAGCCACAGG - Intronic
918040592 1:180912195-180912217 GCGGCTGCAGGGAATGCCCCTGG + Intergenic
918423451 1:184386628-184386650 GAGGCTGCTCGGGGGGCAGCCGG - Intergenic
920914784 1:210251348-210251370 GAGGATGCCCTGCAGGCCCCGGG + Intergenic
922555609 1:226529967-226529989 GAGGCTTCAGGGGAGGCTCTGGG - Intergenic
922724327 1:227915410-227915432 GAGGTGGCCCAGGAGGCCCCGGG - Intergenic
924414861 1:243849462-243849484 GAGGATGCACAGGCGTCCCCGGG - Intronic
1063112487 10:3048792-3048814 GAGACTGGGCTGGAGGCCCCAGG + Intergenic
1063130642 10:3173729-3173751 AAGGCTGCATGGCAGGTCCCAGG + Intergenic
1063353108 10:5374212-5374234 GAGGCTGGACGGGAGGGCAGCGG + Exonic
1065134132 10:22651465-22651487 GTTGCTGCGTGGGAGGCCCCAGG - Intronic
1067173955 10:43929554-43929576 GAGTCTCCAGAGGAGGCCCCCGG + Intergenic
1067294086 10:44964550-44964572 GAGGCTGCATGGGTGGCAGCAGG - Intronic
1067302330 10:45023326-45023348 GAGAATGGAAGGGAGGCCCCTGG + Intergenic
1067685475 10:48464162-48464184 CAGGGAGCAGGGGAGGCCCCAGG - Intronic
1068160365 10:53254664-53254686 CAGGCTGCACTGGAGGCACATGG - Intergenic
1069438539 10:68407319-68407341 GAGGGCGCCCGGGCGGCCCCAGG + Intergenic
1069533924 10:69239377-69239399 GTGGCTGCTGGGGAGGCCCAGGG - Intronic
1069664605 10:70146202-70146224 GGGGCTGCAGGGGACGCCCGCGG + Exonic
1069947714 10:71999256-71999278 GAGGCGGCAGGGGAGCCCCCAGG - Intronic
1070528574 10:77316470-77316492 GAGCCTGCACGGGACTCTCCTGG + Intronic
1070566463 10:77606985-77607007 GAGTCTGAACTTGAGGCCCCAGG - Intronic
1070828234 10:79403597-79403619 GAGGCTCCAGAGGAAGCCCCGGG - Intronic
1072206136 10:93206834-93206856 GCGGCTGCACGCGCGGCCTCTGG + Intergenic
1072521859 10:96236390-96236412 GAGGCTGCAGGGGAGGCGGTGGG + Intronic
1073511614 10:104046073-104046095 GAGGCTGCTCTGCAGGCTCCAGG - Intronic
1075222730 10:120598952-120598974 GAGACTGCAGGTGAGGCCTCAGG + Exonic
1075263429 10:120981612-120981634 GGGCCTGCAAGGGAGCCCCCAGG - Intergenic
1075658039 10:124174672-124174694 GGGCCTGCATGGGAGGACCCTGG - Intergenic
1076535940 10:131177769-131177791 GAGGCTGAAGGGGAGGCTCCTGG + Intronic
1076566742 10:131404205-131404227 GAGTCAGCCCGGGAGTCCCCGGG - Intergenic
1077095904 11:799023-799045 GAGGACCCACAGGAGGCCCCAGG + Exonic
1077102368 11:827871-827893 GAGGTGGGAAGGGAGGCCCCAGG + Intronic
1077161052 11:1113082-1113104 GAGGCTACCCGGGAAGCTCCAGG + Intergenic
1077213236 11:1383063-1383085 GAGGCTGGCTGGGAGGCCCCGGG + Intergenic
1077241378 11:1512299-1512321 GAGTCTGCCGGGGAGGCCCAGGG - Intergenic
1077865380 11:6217703-6217725 GGGGGTGCAGGGGAGGGCCCTGG - Exonic
1080266435 11:30406723-30406745 GTGGTTTCACGGAAGGCCCCAGG - Intronic
1083319106 11:61834497-61834519 GAGGCTGCCCGAGAGCCCTCTGG + Intronic
1083572627 11:63768566-63768588 GCGGCGGCAGGGGCGGCCCCGGG - Exonic
1083769185 11:64856810-64856832 GAGGCAACACTGGAGGCCACAGG + Intronic
1084121554 11:67071860-67071882 CAGGCTGCACAGGCGGCTCCAGG - Exonic
1084169905 11:67396077-67396099 GAGGTAGCAGGTGAGGCCCCGGG - Intronic
1084269905 11:68023177-68023199 GAGGCAGCCTGGGAGGCCCAAGG + Intronic
1084416074 11:69033673-69033695 GAGGTGGGAGGGGAGGCCCCGGG - Intergenic
1089289389 11:117428596-117428618 GAGGCGGCAGCGGGGGCCCCTGG + Exonic
1090667824 11:128926602-128926624 GAGGCGGCGAGGAAGGCCCCCGG - Intergenic
1091772613 12:3162866-3162888 GAGGCAGCCCTGGAGGCCCCAGG + Intronic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1095715750 12:45344416-45344438 CAGGCTGTACAGGAGGCCTCAGG + Intronic
1096754968 12:53791948-53791970 GAGGGTGCAAGGGTGGCCCAAGG - Intergenic
1097046164 12:56189223-56189245 GGGGCTGCTTGGGAGGCCGCGGG + Intronic
1097182441 12:57179057-57179079 GAGGCTGGAGGGAAGGCCGCAGG + Intronic
1101692245 12:107093306-107093328 GAGCCGGCACGGACGGCCCCAGG + Exonic
1101872429 12:108577135-108577157 GGGGCAGGATGGGAGGCCCCTGG - Intergenic
1102038955 12:109788387-109788409 GAAGCTGCAGGTGAGGCCCCAGG - Exonic
1102400956 12:112629202-112629224 AATGCTTCTCGGGAGGCCCCAGG + Intronic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1102965920 12:117125280-117125302 GTGGCTGCACGAGATGGCCCAGG - Intergenic
1103528039 12:121580400-121580422 GAGGGAGCCCGGGAGGCACCGGG + Intronic
1104421951 12:128643321-128643343 AGGGCCGCAAGGGAGGCCCCTGG + Intronic
1106226901 13:27792900-27792922 GAGGCAGCGCGGGCGGCCCGGGG - Exonic
1110448928 13:75619138-75619160 GAGGCTTCTAGGGAGGCCTCAGG + Intergenic
1111396386 13:87673059-87673081 CAGGCCGCACCGGAGGCTCCGGG - Intronic
1112328425 13:98459358-98459380 GAAGCTGCAGGTGAGGCCTCGGG + Intronic
1112561736 13:100521333-100521355 GGGGCTGGACGGGTGGCCCCTGG + Intronic
1112713767 13:102160212-102160234 GAGGATGCTAGGGAGGCACCAGG - Intronic
1113794532 13:113049356-113049378 GGGGCTGGCGGGGAGGCCCCAGG + Intronic
1114454717 14:22847193-22847215 GGGGCTTCACGAGAGGCCACAGG + Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1117829107 14:59732914-59732936 GAGACTGCATTGGAGCCCCCCGG + Intronic
1117912753 14:60650011-60650033 GAGGCTGCATGCGCGGACCCTGG - Intronic
1118473322 14:66094538-66094560 GAGGCTGCAGCGGAGGCTCTGGG + Intergenic
1118864698 14:69693767-69693789 AAGGCTGCAGAGCAGGCCCCTGG + Intronic
1119309529 14:73634304-73634326 GAGGCTCCACAGGAGCCCCATGG - Intergenic
1121320166 14:92987482-92987504 ATGGCTGCACAGGTGGCCCCTGG + Intronic
1121414040 14:93766615-93766637 CATGCTGCATGTGAGGCCCCAGG - Intronic
1121671468 14:95713898-95713920 GAGGCAGCAGGGGCAGCCCCTGG - Intronic
1122077849 14:99247011-99247033 GAGGCGGGACGCGAGGCTCCAGG - Intronic
1122155895 14:99750245-99750267 GAGGCTCCCCTGGTGGCCCCCGG + Intronic
1122208231 14:100159168-100159190 GAGGGCGCAGGGGCGGCCCCGGG - Intronic
1122387198 14:101357190-101357212 GAAGCTGCAGGAGAAGCCCCAGG + Intergenic
1122784608 14:104157949-104157971 AAGGCTGCCCAGGAAGCCCCAGG - Intronic
1122883245 14:104699459-104699481 GAGGCTGCCTGGGAGGGACCCGG + Intronic
1122956837 14:105075129-105075151 GGGGCTGCAAAGGAGGCCCAGGG - Intergenic
1123047640 14:105526604-105526626 GAGGCTGGGCGGGCGGGCCCGGG + Exonic
1123756151 15:23399140-23399162 GAAGCTGAGCCGGAGGCCCCTGG - Intergenic
1124941804 15:34225191-34225213 GAGGCAGCAGGTGAGGCACCTGG + Exonic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1125815659 15:42581647-42581669 GAGGCTGCTGGCGAGGCCCGAGG - Intronic
1126097508 15:45099947-45099969 GAGTCTGCATGGGAGAGCCCAGG - Intronic
1126548066 15:49894732-49894754 GAGCCTGCAGGGATGGCCCCTGG + Intronic
1128139070 15:65286349-65286371 GAGGCTGCACCGGAGGTCGGCGG + Exonic
1128982897 15:72199388-72199410 AATGCTGGACTGGAGGCCCCTGG - Exonic
1129514227 15:76147132-76147154 AGAGCTGCACGGGAGGCCCCAGG + Intronic
1131366782 15:91848146-91848168 GAGGATGCAGAGGAGGTCCCTGG + Intergenic
1131846071 15:96491906-96491928 CAGGCCGCACAGGAGCCCCCGGG + Intergenic
1132326469 15:100973985-100974007 GGGGCTGCATGGGTGGCCGCAGG - Intronic
1132519794 16:381873-381895 GAGGCTGCCCGGGCGGCGGCGGG - Exonic
1132690017 16:1178093-1178115 GAGGGGGCGGGGGAGGCCCCAGG - Intronic
1132797507 16:1732510-1732532 CAGGCTCCACGGCACGCCCCTGG - Intronic
1133019474 16:2960864-2960886 GAGGCCGCTGGGGAGGCCCTGGG - Intergenic
1133111091 16:3548783-3548805 GAGGCTTCACAGCCGGCCCCCGG - Intronic
1133184366 16:4085056-4085078 GAGGCTGAAAGGGAGGACACTGG + Intronic
1134460180 16:14423580-14423602 GAAGCTGAGCTGGAGGCCCCTGG + Intergenic
1135517663 16:23149145-23149167 GCGGCGGCGCGGGGGGCCCCGGG - Exonic
1137275690 16:46931937-46931959 GAGGGAGCACTGGAGGCCCGTGG + Intergenic
1138534831 16:57654238-57654260 GAACCTTCTCGGGAGGCCCCAGG - Intronic
1138552463 16:57755067-57755089 GAGGCAGAGAGGGAGGCCCCAGG + Intronic
1139322821 16:66129190-66129212 CAGGCTGCCCGGGAGGCAACAGG + Intergenic
1139420965 16:66849279-66849301 GAGGCGGCACTGGAGGCACCTGG + Intronic
1139908465 16:70381942-70381964 GAGAGGGGACGGGAGGCCCCGGG + Intronic
1140922686 16:79553393-79553415 GAGGCAGCCCTGGAGGCTCCTGG + Intergenic
1142082686 16:88158330-88158352 GTGGGGGCACGGGAAGCCCCCGG + Intergenic
1142217915 16:88838905-88838927 GAGGCAGCTCGGGAGGTCCAGGG - Intronic
1142356379 16:89603836-89603858 GAGGCTGGAGGGGAAGCCCTGGG + Intergenic
1142356472 16:89604097-89604119 GAGGCTGGAGGGGAAGCCCTGGG + Intergenic
1143140865 17:4741044-4741066 GAGGCTGCCCGGGAGGCAGGAGG + Exonic
1143166410 17:4899317-4899339 GAGGCGGCCCGGGGGGCCTCGGG + Exonic
1144443128 17:15301756-15301778 GAGGCTGCAAGGGAAGACTCGGG + Intergenic
1144496587 17:15749755-15749777 GAGGCTGCCCTGGAGCCCGCTGG + Intergenic
1144582143 17:16465053-16465075 GAGGCTGCACTGGTGGCCACGGG + Intronic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1144765534 17:17730586-17730608 GAGGCTGCACTAGTGGCCCCAGG - Intronic
1144839014 17:18174202-18174224 GAGGCTGGATTGTAGGCCCCAGG + Intronic
1144904991 17:18634944-18634966 GAGGCTGCGCTGGAGCCCGCTGG - Intergenic
1145250202 17:21293294-21293316 GAGGCAACACGGGAGGACCCCGG - Intronic
1146641616 17:34546248-34546270 GGGGCTCCATGTGAGGCCCCCGG - Intergenic
1146681779 17:34813575-34813597 GAAGCTGCACGGGGAGGCCCTGG + Intergenic
1147740888 17:42670373-42670395 GAGCCTGCAGGGGAGGCACCCGG + Exonic
1148384336 17:47223316-47223338 GAGCCTGTACAGGAGGCCCCAGG - Intronic
1149185594 17:53993289-53993311 GAGGCTACTCGGGAGCCCACAGG + Intergenic
1149545964 17:57504212-57504234 GAGGCTGGATGGGAGACCACGGG - Intronic
1149958858 17:61084501-61084523 GAGACTGGACGGGATGACCCTGG - Exonic
1150791832 17:68205578-68205600 GAGGCCGCGCGGGAGGGCCCCGG - Intergenic
1151651965 17:75475710-75475732 GAGGCTGCCCGGGAATGCCCAGG - Intronic
1151890682 17:76949028-76949050 GAGCCTGCCTGGGAGGTCCCAGG - Exonic
1151954212 17:77372698-77372720 GAGGGTGCAGCGGTGGCCCCCGG + Intronic
1152281109 17:79385287-79385309 GAGGCTGCAAGGGAAACACCAGG + Intronic
1152293586 17:79454255-79454277 GAGGCCTCAAGGGAGGGCCCTGG - Intronic
1152773431 17:82185063-82185085 GAGACTGTCCAGGAGGCCCCAGG - Intronic
1152786058 17:82248698-82248720 GAGGCTTCTCGGGAGGGCCTGGG - Intronic
1152818189 17:82421237-82421259 GAGGGTGCAGGGGAGGCCCAAGG + Intronic
1153541393 18:6159629-6159651 GTCCCTGCACGGGAGGCTCCAGG + Intronic
1153572722 18:6489312-6489334 GGGGGTGCAGAGGAGGCCCCAGG - Intergenic
1157679231 18:49590802-49590824 CAGTGTGCACGAGAGGCCCCAGG - Exonic
1158974275 18:62696722-62696744 GAGGCAGCAAGGCAGGGCCCAGG - Intergenic
1160038563 18:75322596-75322618 GTGGGTGCAGGGCAGGCCCCAGG - Intergenic
1160404470 18:78635563-78635585 GAGGCTGCAGCTGATGCCCCCGG + Intergenic
1160418935 18:78731189-78731211 GGCTCTGCACGGGAGGCACCAGG - Intergenic
1160543638 18:79638709-79638731 GAGGCTTCCCTGGAGGTCCCCGG + Intergenic
1160779740 19:872486-872508 GAGGCCCCAGGGGTGGCCCCTGG + Intronic
1160976899 19:1797091-1797113 GTGGCTGCACCAGTGGCCCCCGG - Intronic
1161112106 19:2476311-2476333 GCGGCTCCACGGCAGTCCCCAGG - Exonic
1161133940 19:2608631-2608653 GGGGTTGCCCGGGAGGCACCCGG - Intronic
1161295277 19:3516588-3516610 GAGGTGCCCCGGGAGGCCCCAGG + Intronic
1161761487 19:6176236-6176258 GAGGCTGAAGTGGGGGCCCCAGG + Intronic
1161857198 19:6772773-6772795 GAGGGTGCACGGCCGGCCCTGGG + Exonic
1162995742 19:14333823-14333845 GAGGCTGGAGGGGAAGACCCAGG + Intergenic
1163040289 19:14597052-14597074 GAGGGTGCACAGGAGGACCTGGG + Intronic
1165476195 19:36032438-36032460 GAGGGTGCCCGGCAGGCTCCAGG + Intronic
1165712844 19:38024432-38024454 AAGGCTGCAAGCGAGGCTCCAGG - Intronic
1165767416 19:38360013-38360035 GAGGCTGGAGGGGATCCCCCAGG + Intronic
1166098151 19:40554469-40554491 GAGGCGGCAGCGGCGGCCCCCGG - Intronic
1166194067 19:41194619-41194641 GAGGCTGTGCGGGAGGCCCTGGG + Exonic
1166318822 19:42003792-42003814 GAGGCTGCAGGGAAGACCCTGGG - Intronic
1166501264 19:43343352-43343374 GCGGCTGCTCGGGAGGACTCTGG + Intergenic
1166738877 19:45102349-45102371 GAGGCAGCACGGGAGCCCCCTGG + Intronic
1166918289 19:46211158-46211180 GAGGCTGGAGGAGAGGCCCCAGG - Intergenic
1166920528 19:46226382-46226404 GGGGCTGGAGGAGAGGCCCCAGG - Intergenic
1167265529 19:48481073-48481095 GAGGTTGCAGGAGGGGCCCCTGG + Intronic
1167289716 19:48617681-48617703 GAGACTGCTCTGCAGGCCCCTGG + Intronic
1167526301 19:49985991-49986013 GAGGATGCAGGGGAAGCACCAGG + Intronic
1167743491 19:51338127-51338149 GAGGTGGCACTGGAGGCCTCTGG - Exonic
1168279665 19:55298134-55298156 AATGCTGCACGTGAAGCCCCTGG + Intronic
1168501505 19:56897122-56897144 ATGGCTGCAGGGGAGGCCACAGG + Intergenic
925179998 2:1811449-1811471 CAAGCCGCACGGGAAGCCCCAGG + Intronic
925386736 2:3467181-3467203 CAGGCTGCAAGGGAAGCCCTCGG + Intronic
925456767 2:4022790-4022812 GAGGCTGACCTGGAGCCCCCAGG - Intergenic
925482861 2:4296253-4296275 GTGTCTGCACAGGAGTCCCCTGG - Intergenic
926108955 2:10170034-10170056 AAGGCAGCATGGGAGGCCCCCGG + Intronic
926125295 2:10268104-10268126 GAGGGTGCACGGGGGCCCACAGG + Intergenic
927567254 2:24123729-24123751 GCGCCTGCGCGGGAGGCCCCCGG + Intronic
927940717 2:27101419-27101441 GAGGCTGAAGGAGATGCCCCCGG - Exonic
927940736 2:27101470-27101492 GAGGCTGAAGGAGATGCCCCCGG - Exonic
928077618 2:28279465-28279487 GAGGCTGCACGAAAGGCTGCTGG - Intronic
928100823 2:28436597-28436619 CAGGCTGCAGGGGAGAGCCCTGG - Intergenic
929534054 2:42769680-42769702 GAGGATGCCCCGGATGCCCCAGG + Intronic
929604193 2:43224576-43224598 GCGGCTGCGCGGGGGGCGCCAGG + Exonic
931006087 2:57850787-57850809 GAGGCTGCAGCAGAGGCTCCAGG + Intergenic
931071075 2:58650919-58650941 GATGCTGGAGGTGAGGCCCCAGG + Intergenic
931442862 2:62303720-62303742 GAGGCTCCACGCAAGACCCCAGG + Intergenic
931711006 2:64989174-64989196 GAGGCTCCACCCGAGGCCGCGGG - Intronic
936046551 2:109192737-109192759 GTGGCTGCACTGGAAGCCCCAGG - Intronic
936080242 2:109428035-109428057 GGGGCTGCACTGGAGGCCAGGGG - Intronic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
938071847 2:128312546-128312568 GAGGGTGCACCCCAGGCCCCTGG + Intronic
938087729 2:128412320-128412342 CAGGCTGGATGGGATGCCCCTGG + Intergenic
941813380 2:169776484-169776506 GTGGCTGCACGGCAGGGCCTAGG - Intronic
941918045 2:170824643-170824665 GAAGCTGCAAGGAAGGCCCTGGG + Intronic
944307569 2:198195423-198195445 CAGGCTGTACAGGAGGCCTCAGG + Intronic
944992445 2:205253546-205253568 GAGGAGGCAGGGGAGGCTCCAGG - Intronic
947633204 2:231666655-231666677 GAGGCTGCTGGGGAGGGCCAGGG + Intergenic
947766434 2:232640867-232640889 GAGGCAGCAGGGAAGGCCCTTGG + Intronic
948190355 2:236053459-236053481 GGGGCTGCACGGCAGCGCCCTGG + Intronic
948429856 2:237912361-237912383 GAGCCTGCACCCAAGGCCCCAGG - Intergenic
948577317 2:238963322-238963344 GAGGCTGCTGGTGAGGCCCACGG - Intergenic
948668710 2:239552629-239552651 GAGGCTGCCAGAGTGGCCCCAGG + Intergenic
948766938 2:240227233-240227255 CAGCCTGCACTGGAGGCCTCAGG - Intergenic
948903029 2:240965669-240965691 GAGGCCGCAGGGGAGGCCCATGG + Intronic
1168849966 20:969725-969747 GAGGCAGCAGGGGAGACCACTGG + Intronic
1168979102 20:1989910-1989932 TAGGGTCCACGGGAGGCACCTGG - Intronic
1171358838 20:24572354-24572376 GAGACTGGGCGGGAGGCTCCTGG + Intronic
1171413988 20:24965267-24965289 GAGGCGGCAGGGCAGGGCCCAGG - Intronic
1171427547 20:25058152-25058174 GAGACTCCACGGGGCGCCCCGGG - Exonic
1172095262 20:32457292-32457314 GAAGCTGCACGGGAACTCCCGGG + Intronic
1175832940 20:61976911-61976933 GAGGCAGCTCGGGAGACACCTGG - Intronic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176084771 20:63290914-63290936 GAGGCTGCACAGGAGGCCACTGG + Intergenic
1176121647 20:63456795-63456817 GAGGCTGCGTGGGACCCCCCAGG - Intronic
1176134327 20:63514579-63514601 CAGGCTGTACAGGAGGCCTCAGG + Intergenic
1176137285 20:63529807-63529829 GAGGCTGCGGGGAAGGCCCCAGG - Intronic
1176151314 20:63592536-63592558 GAAGCTGCAGGGGAGGGTCCTGG + Exonic
1178955554 21:37018313-37018335 GAGGCTTCTCGGGCAGCCCCTGG + Exonic
1179466929 21:41581971-41581993 GAGTCTGAACGGAAGGCGCCAGG + Intergenic
1179554474 21:42163489-42163511 GAGGCTGCTGAGGAGGCTCCTGG + Intergenic
1179784623 21:43722373-43722395 GAGGCTGCCCTGAGGGCCCCAGG - Intronic
1179960801 21:44766176-44766198 GAGGCTGCCCAGCAGGCCCCTGG + Intergenic
1180049725 21:45325627-45325649 GAGGCTGCTCGGGAATCCCAGGG - Intergenic
1180166610 21:46033813-46033835 GAGGCAGCACGGGATGCCGGGGG + Intergenic
1180739702 22:18044599-18044621 GAGGGTGCACGGGAGGTCAGTGG + Intergenic
1180972842 22:19824630-19824652 GAGGCAGCTCGGCAGGCCCCAGG + Intronic
1181625273 22:24118742-24118764 GGTGCTGCACGGCTGGCCCCAGG - Intronic
1182237012 22:28883834-28883856 GCGGCTGCACCGGAGGCCGCGGG - Exonic
1182486515 22:30642342-30642364 GAGGCTCCAGGAGAGGCACCAGG + Intronic
1182566944 22:31207085-31207107 GAGGATGCACAGGAGCCTCCAGG - Intergenic
1182694496 22:32187524-32187546 GAGGCTGCTTGGGTGGCTCCAGG - Intergenic
1182695666 22:32198022-32198044 GAGGATGGAAGGGAGACCCCTGG + Intronic
1182716803 22:32363583-32363605 GAGGCTGCTTGGGTGGCTCCAGG + Intronic
1184196483 22:42932829-42932851 GGGGCTGCCCAGGAGGCTCCAGG - Intronic
1184373535 22:44097712-44097734 GAGGGTGGACAGCAGGCCCCAGG - Intronic
1184479743 22:44739314-44739336 GGGGCAGGAGGGGAGGCCCCTGG + Intronic
1184560546 22:45260634-45260656 GAAGCTGCACGGGAACCACCAGG + Intergenic
1184723365 22:46328935-46328957 GAGGCTGCTCGGGAAGCCCGTGG + Intronic
1185089070 22:48755834-48755856 GAGGCTGCACCTGAGGCCTGGGG - Intronic
1185177220 22:49334821-49334843 GGGCCTGCACGGGAGGATCCTGG - Intergenic
1185244440 22:49765698-49765720 GGGGCTGTAAGGGAAGCCCCTGG - Intergenic
950040752 3:9917708-9917730 GAGGCGGCAGGAGAGGCCCTGGG - Exonic
951718641 3:25674693-25674715 GAGGCTGCAGCAGAGGCTCCAGG + Intergenic
953877375 3:46674012-46674034 GAGGGTGGAAGGGAGGCCCTGGG + Intronic
956489124 3:69752903-69752925 GAGGCTTCAGGGGAGGCCTCAGG - Intronic
958176924 3:90007800-90007822 AAGGCTGCACAGGAGGCTCTGGG + Intergenic
958470195 3:94507606-94507628 GCGGCAGCATGGGTGGCCCCCGG - Intergenic
960047343 3:113211254-113211276 AAGGCTTCAGGGGAGCCCCCTGG + Intronic
961423696 3:126828462-126828484 GAGGGAACACGGGAGGCTCCCGG + Intronic
961655561 3:128439767-128439789 GGGGCTGCCCGGGAGGCACTGGG + Intergenic
962508762 3:136077135-136077157 CACGCTCCATGGGAGGCCCCAGG - Intronic
962813124 3:138975585-138975607 GAGGCCGGAAGGGAGGCCACAGG + Intergenic
963397251 3:144750096-144750118 CAGGCGGCACAGGAGCCCCCGGG - Intergenic
968490955 4:890254-890276 GAGGCTCCAGGGCAGGGCCCAGG - Intronic
968556875 4:1249964-1249986 GAGTCTGCAGGGGCAGCCCCTGG - Intergenic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968734297 4:2287418-2287440 GCTGCTGCACGTGAGGCCCGAGG - Intronic
968820205 4:2844127-2844149 GAGGCTGCCCGGGCCGCCGCAGG - Intronic
969543744 4:7810588-7810610 GGGGCTGGAAGGCAGGCCCCTGG - Intronic
975437179 4:74366017-74366039 GAGGCTGCTTGGGAGGCTGCAGG - Intronic
976392003 4:84515534-84515556 GTGGCTGCAAGGCAGGCCCCAGG - Intergenic
977894064 4:102344783-102344805 GAGGTGGCGCGGGACGCCCCTGG + Exonic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
985496974 5:214200-214222 AGGGCAGCACGTGAGGCCCCAGG + Intronic
985765517 5:1777449-1777471 GACGCCGCACGGGAGGCGCAGGG - Intergenic
985838511 5:2288592-2288614 GAGGCTGCCGGGGAGGGCTCCGG - Intergenic
986530012 5:8726574-8726596 AATGCTGGACTGGAGGCCCCAGG + Intergenic
986668011 5:10119725-10119747 GAGGCTCCGAGGGAGGCCTCAGG - Intergenic
991674253 5:69075766-69075788 GAGGCTGCACAGGAAGCCGAGGG - Intergenic
992050397 5:72935526-72935548 CTGGCTGCACGGGAGCCCACTGG - Intergenic
992078643 5:73214523-73214545 GAGGCTGCTCTGGAGCCCCCTGG + Intergenic
992795967 5:80255659-80255681 GAGGCCGGACGGGAAGACCCCGG + Intronic
998385252 5:141753664-141753686 GAGCCAGCCCGGGAGCCCCCGGG - Intergenic
998503352 5:142652657-142652679 CAGGCTGCACGTGTGGGCCCAGG - Intronic
1001688675 5:173616147-173616169 GGGGCTGCACGTGAGGCCGCCGG - Intronic
1002435417 5:179228153-179228175 GAGGGTGGGCCGGAGGCCCCAGG + Intronic
1002633869 5:180597667-180597689 GAAGCCTCACGGGAGGGCCCTGG - Intergenic
1002859165 6:1064794-1064816 GAGGCTGGCTGGGAGGGCCCAGG + Intergenic
1002929658 6:1624483-1624505 GAAGCTGAACTGGAAGCCCCGGG - Exonic
1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG + Intronic
1003065788 6:2902922-2902944 GAGGCTGCAGGGGAGGGCTTCGG + Intronic
1003086383 6:3064317-3064339 GAGGCTGCAGGGGAGGGCTTCGG - Intronic
1003422050 6:5967516-5967538 CAGGCTGACCAGGAGGCCCCAGG + Intergenic
1004025504 6:11814382-11814404 GAGGCTGGTTGAGAGGCCCCTGG + Intergenic
1004864551 6:19838958-19838980 CAGACTGCACGGGAGGACACCGG - Intronic
1005114233 6:22318491-22318513 GAGGCTGCAGGGGAGCCCACCGG + Intergenic
1005997651 6:30941031-30941053 GAGGCAGCACTGGAGGCCAAAGG - Exonic
1006164894 6:32058313-32058335 GAGGCTCCTCGGGGGGCCCTGGG + Intronic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006423506 6:33949852-33949874 GAGGCAGCACGGGAGCAGCCAGG + Intergenic
1006461811 6:34163719-34163741 GAGGAGGCGCGGGAGGCCCGGGG - Intergenic
1007462889 6:42030870-42030892 AAGGCTGGAGGGGAGGCCCCTGG + Intronic
1007594472 6:43043119-43043141 GATGCTGCTTGGAAGGCCCCGGG + Exonic
1007756028 6:44100250-44100272 GAGGCTGCAGGACAGGCCCTGGG + Intergenic
1008092834 6:47309668-47309690 GAGGCGGCAAGGGAGGCTCTAGG + Exonic
1009995657 6:70892626-70892648 AGGGCTGCACTGGAGGGCCCTGG + Intronic
1010760008 6:79711789-79711811 GAGGCTGTACTAGAGGCCTCTGG + Intergenic
1013590163 6:111613067-111613089 GAGGCTGCCCTGCAGGGCCCTGG + Intergenic
1015842982 6:137493252-137493274 GAGGCTGCACGCTCGGCCCACGG - Exonic
1017764006 6:157592657-157592679 TAGGCGGCAGGAGAGGCCCCAGG - Intronic
1017787567 6:157769187-157769209 GTTGCTGCATGGGAGGCCCGAGG - Intronic
1017880722 6:158560589-158560611 GAGGCTGCCCGGGAGGCGGCGGG - Intronic
1018853300 6:167657135-167657157 GAGGCTCCACAGGTGGCCCCTGG - Intergenic
1019051513 6:169187069-169187091 GAGGCTGCACGGGGCTTCCCCGG - Intergenic
1019325678 7:437029-437051 GTGGGTGCAGTGGAGGCCCCAGG - Intergenic
1019400358 7:848691-848713 GAGGCAGCGAGGGAGGCGCCTGG - Intronic
1019409752 7:901327-901349 TAGGCTGAACAGGAGGCCCAGGG - Intronic
1019490168 7:1308987-1309009 GAGGCTGCAATGGAAACCCCAGG - Intergenic
1020011844 7:4809524-4809546 GCGGCTGCTCGGGAGCCCCCAGG + Intronic
1020013735 7:4819591-4819613 GAGGCGGCGCGGGAGGGGCCTGG + Intronic
1020104804 7:5417758-5417780 GAGGCGACAAGGGAGGCCCTGGG - Intronic
1021193831 7:17652377-17652399 GAGGCTACAAGAGGGGCCCCAGG - Intergenic
1021573944 7:22090715-22090737 CAGGCCGCACGGGAGCCCACAGG - Intergenic
1022028248 7:26468301-26468323 GGGGCTGCAAGGGAGGCCGGGGG + Intergenic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1023907683 7:44533832-44533854 GAGGCTGCCCCGGAGGCCTGGGG - Exonic
1023982318 7:45077225-45077247 GGGGCTGCATGTCAGGCCCCAGG + Intergenic
1024219546 7:47277154-47277176 TAGGATGCACCGCAGGCCCCTGG - Exonic
1024235361 7:47393606-47393628 GAGGCTGCAAGGGATGAACCAGG + Intronic
1024556264 7:50605638-50605660 AAGGCTGCTGGTGAGGCCCCCGG + Intronic
1026894269 7:74000863-74000885 GGGGCTGCAGGGGAGGACGCTGG + Intergenic
1028913028 7:96228996-96229018 CAGGCTGCATGGGAGCCCACGGG - Intronic
1029225831 7:99027969-99027991 GAGGCTGCCTGGGAGGCCCGGGG - Exonic
1029506321 7:100965956-100965978 GAGGCTCCACTGTAGGCCCAGGG - Intronic
1029813993 7:103075265-103075287 GCGGCAGCATGGGTGGCCCCCGG + Exonic
1032683495 7:134209122-134209144 AAGGGTGCACAGGAGGCACCAGG - Intronic
1034121641 7:148633303-148633325 GTGGCTTCTGGGGAGGCCCCAGG - Intergenic
1034344778 7:150379477-150379499 GAGGCAGCACGGGAGGAGCGGGG - Intronic
1034690329 7:153008550-153008572 GAGGCTGCCCGGGACAGCCCCGG - Intergenic
1034835963 7:154351785-154351807 GAGCCTGCATGGGGGGCCTCTGG + Intronic
1035000779 7:155610710-155610732 GAGGCTGCACGTGGAGACCCAGG - Intergenic
1035428139 7:158795911-158795933 AAGGCTGCACAGGAGGCACGGGG + Intronic
1035602318 8:903937-903959 GGAGCTGCACGGGAGGCATCAGG + Intergenic
1036210314 8:6835475-6835497 GAAGATGCACGCGAGGCTCCTGG - Exonic
1036645372 8:10608966-10608988 GAGGCAGCAGAGGTGGCCCCTGG - Exonic
1037745962 8:21644336-21644358 GAGGCTCCACGTGGGGCTCCTGG + Intergenic
1037882264 8:22579060-22579082 GCGGCGGCAGGGGCGGCCCCGGG + Exonic
1039709127 8:40037781-40037803 GAGGCTTCCAGGGAGCCCCCTGG + Intergenic
1039780169 8:40777471-40777493 GAGGCTGCCTGGGAGGCCCGGGG - Intronic
1040928824 8:52713924-52713946 GTGTGTGCACGGGAGGGCCCCGG - Intronic
1042563680 8:70092452-70092474 GAGGCTGCAGGGGTGTCCCGCGG + Intergenic
1043050290 8:75377257-75377279 AATGCTGGACTGGAGGCCCCAGG + Intergenic
1045251544 8:100487124-100487146 GAGGCTCCACGGGGGACCCAGGG - Intergenic
1047407257 8:124595925-124595947 GAGGCTGCTGGGGAGGCCTCTGG + Intronic
1047782412 8:128120775-128120797 GAGGCTGTCAGGCAGGCCCCAGG + Intergenic
1048319196 8:133385376-133385398 GCTGCTGCACGGGAGGTCCCTGG - Intergenic
1049225804 8:141449947-141449969 GGGGCTGGACAGGAGGCCCCTGG + Intergenic
1049302794 8:141880446-141880468 GAGGCATCACGGGAGCCCCGTGG - Intergenic
1049444868 8:142625243-142625265 GAGGCTGAACTGGGGGCCCTGGG - Intergenic
1049509012 8:143018493-143018515 GCGGCTGCCTGGGAGGCTCCGGG + Intronic
1049685334 8:143937140-143937162 AAGGCTGCCCGGCAGGCCCTGGG - Intronic
1049778316 8:144416312-144416334 GTGGCTCCAGGGGAGTCCCCTGG - Intronic
1051513912 9:17907632-17907654 GAGGCGGCGCGGAAGGGCCCTGG + Intergenic
1057040062 9:91841643-91841665 GAGGCTGCTCAGGAGCCCACCGG - Intronic
1057064261 9:92033942-92033964 GAGGCTGCAGGAGAGCCCACTGG - Intronic
1057081693 9:92178487-92178509 GTGCCTGCACTGGATGCCCCAGG - Intergenic
1060228592 9:121811255-121811277 GAGGCTGCCCGGGCAGCGCCAGG - Intergenic
1060509010 9:124218724-124218746 GAGGCAGCACTCTAGGCCCCAGG + Intergenic
1060553529 9:124496842-124496864 GAGGATGCAAGGGAGGACCCGGG - Intronic
1061258028 9:129464085-129464107 GAGGCTGCAGGCGCTGCCCCCGG - Intergenic
1061549276 9:131323966-131323988 GATGCTGCACAGAAGGTCCCTGG + Intergenic
1061824884 9:133251960-133251982 GAGGCTGCAGGGGAGGAAGCGGG + Intronic
1061971320 9:134046999-134047021 GAGGCTGCAGCCGAGGCTCCTGG + Intronic
1062040504 9:134402254-134402276 GAGACTTCAGGGGAGGACCCAGG - Intronic
1062242965 9:135549703-135549725 GAGGCTGCTCTGGAGCCCCGAGG + Exonic
1062322520 9:135997338-135997360 GAGGCTGCACGGCTGTGCCCGGG - Intergenic
1062601622 9:137320966-137320988 AAGGCTGCAGGAGAGGCCCCTGG + Intronic
1062619066 9:137411415-137411437 GAGGCTCCCTGGGAGGCCGCCGG - Intronic
1062707607 9:137954022-137954044 GGGGCTGGAGGGGAGGCCCAAGG + Intronic
1185449718 X:275767-275789 GAGGCGGCACGGGCTGCCCAGGG + Intergenic
1185888262 X:3802159-3802181 GAGGCTCTAGGGGAGGCTCCAGG - Intergenic
1190008082 X:46759033-46759055 GAGGAGGCGCGGGGGGCCCCGGG - Exonic
1190276909 X:48904804-48904826 GTGGCTGCCCGGGAGGCTGCTGG + Exonic
1192858548 X:75040199-75040221 GAGGCTGGAATGGGGGCCCCAGG + Intergenic
1193425441 X:81336805-81336827 GAGGCTGCATTGTAGGCCCAAGG + Intergenic
1195196232 X:102500112-102500134 GAGGCTTCACAGGAGCCTCCTGG - Intergenic
1199964426 X:152807731-152807753 GACGCTGCACTGCAGGCCCTGGG - Intergenic
1200068151 X:153514798-153514820 GAGGCTGAGAGGGAGGGCCCAGG - Intergenic
1200180030 X:154144423-154144445 GTGGCTGCACTGGGGGCCACCGG + Intronic
1200185858 X:154182817-154182839 GTGGCTGCACTGGGGGCCACCGG + Intergenic
1200191510 X:154219955-154219977 GTGGCTGCACTGGGGGCCACCGG + Intronic
1200197265 X:154257759-154257781 GTGGCTGCACTGGGGGCCACCGG + Intronic