ID: 1175889707

View in Genome Browser
Species Human (GRCh38)
Location 20:62310745-62310767
Sequence GCTGCCGGTGCGGCCCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175889692_1175889707 23 Left 1175889692 20:62310699-62310721 CCGCCCACAAAGAGGGTGTGGGG 0: 1
1: 0
2: 4
3: 20
4: 191
Right 1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 252
1175889695_1175889707 19 Left 1175889695 20:62310703-62310725 CCACAAAGAGGGTGTGGGGCTGG 0: 1
1: 0
2: 1
3: 27
4: 298
Right 1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 252
1175889694_1175889707 20 Left 1175889694 20:62310702-62310724 CCCACAAAGAGGGTGTGGGGCTG 0: 1
1: 0
2: 1
3: 13
4: 198
Right 1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175889707 Original CRISPR GCTGCCGGTGCGGCCCCTCC TGG Exonic
900489376 1:2939271-2939293 GCAGGCTGTGCAGCCCCTCCAGG + Intergenic
900595579 1:3478805-3478827 ACTGTTGGTGCGTCCCCTCCCGG - Intronic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
902241205 1:15090553-15090575 GCTGCCTCTGCAGCCCCGCCAGG - Intronic
902450070 1:16491217-16491239 CCTGCCGCTGCTGGCCCTCCAGG + Intergenic
902467726 1:16628541-16628563 GCTGGCGCTGCAGCTCCTCCTGG + Intergenic
902472245 1:16657076-16657098 CCTGCCGCTGCTGGCCCTCCAGG + Intergenic
902486558 1:16750370-16750392 CCTGCCGCTGCTGGCCCTCCAGG - Intronic
902504396 1:16929980-16930002 CCTGCCGCTGCTGGCCCTCCTGG - Exonic
903724315 1:25430043-25430065 GCTCCCGGTCCGGCCCGGCCCGG + Intronic
904642039 1:31938284-31938306 GCTGCCGCTCCAGCCGCTCCCGG + Exonic
906027002 1:42682514-42682536 GCGGCAGCTGCGGCTCCTCCCGG - Exonic
907240074 1:53076331-53076353 GCTGCCGGGGAGCCGCCTCCAGG + Intronic
907298433 1:53470310-53470332 GCTGCCGTCGCGCCCTCTCCCGG - Intergenic
907950376 1:59177920-59177942 GTTGCCTGTCTGGCCCCTCCAGG - Intergenic
915070497 1:153261701-153261723 GCTGCGGCGGCGGCTCCTCCGGG + Exonic
915083167 1:153365933-153365955 GCTGCCCCTGCCGCCCCTGCTGG - Intergenic
916168130 1:161981365-161981387 GGTGCCCGTGGGGCCCCTTCAGG + Intergenic
917121924 1:171652251-171652273 GCTCCCTCTGCAGCCCCTCCTGG + Exonic
918423665 1:184387406-184387428 GCTGGCGGTGCAGCCCGCCCCGG + Intronic
919762018 1:201103947-201103969 GCTGCCCATTTGGCCCCTCCTGG - Intronic
922565171 1:226596989-226597011 GCTGTTGGTGCTGCGCCTCCTGG + Intronic
1063949861 10:11212324-11212346 GCTCCCTGTGAGGCCCCCCCGGG + Intronic
1065533576 10:26697544-26697566 GCTGCCGGCGCGGACACTTCGGG - Intergenic
1067562365 10:47312782-47312804 CCTGCCGGTGAGACCACTCCAGG + Exonic
1067779616 10:49190263-49190285 GCTGCAGATGCTTCCCCTCCTGG - Intergenic
1067806241 10:49395339-49395361 GCTGCCGCTCCGGCCCTTTCTGG + Intronic
1068690107 10:59906053-59906075 GATTCGGGTGCAGCCCCTCCCGG + Intronic
1072190614 10:93073979-93074001 GCTGCCGCTGCTGCTCTTCCTGG + Exonic
1072665710 10:97390890-97390912 GCAGCTGGTGCAGCCCCTCGTGG + Intronic
1074153869 10:110781773-110781795 GCTATCTGTGCGGCCCCTGCAGG + Exonic
1074536079 10:114329448-114329470 GCTGCTGGTGGGTCCCCACCTGG - Intronic
1075566943 10:123511914-123511936 GAGGCAGGTGCAGCCCCTCCAGG + Intergenic
1076589705 10:131574663-131574685 CCTGCCGTGGCTGCCCCTCCTGG - Intergenic
1076871972 10:133198816-133198838 GCTGCCGATGAGGCCCCCTCTGG - Exonic
1077021478 11:419025-419047 GCTTCCAGGGCGGCCCCTTCAGG + Intronic
1077534013 11:3110396-3110418 GCTGCCTGAGCGGCCACTCAGGG + Intronic
1081772693 11:45659515-45659537 GCTGCCAATGCTGCCCTTCCTGG + Intronic
1081814393 11:45930398-45930420 GCTGCCAGGGCGGCCCCACCAGG + Intronic
1082787591 11:57325218-57325240 ACTGCCTTGGCGGCCCCTCCCGG + Intergenic
1083289097 11:61680151-61680173 GCGGCCAGTCCAGCCCCTCCCGG + Intergenic
1083895206 11:65616277-65616299 GCTGCCCGCGCCCCCCCTCCCGG - Exonic
1083949833 11:65947785-65947807 GCTGCCTGTGCAGCTTCTCCAGG - Exonic
1088821982 11:113464291-113464313 ACTTCCGCTGCGGCCCTTCCAGG + Intronic
1090927332 11:131260288-131260310 GCTGCCGCTGTGGCCCGTGCTGG + Intergenic
1095703758 12:45216558-45216580 GGCCCCGGTGCGGCCCCTGCGGG + Intronic
1095810876 12:46372420-46372442 CCTTCCCGCGCGGCCCCTCCCGG + Intronic
1096229415 12:49888968-49888990 CCATCCTGTGCGGCCCCTCCTGG - Intronic
1096469940 12:51869477-51869499 GCGGCCAGAGCCGCCCCTCCCGG - Intergenic
1097042746 12:56165443-56165465 GCTGGCAGTGGGGCCCCTCCAGG - Exonic
1097241176 12:57576298-57576320 GCTGCCGGTGATGGGCCTCCCGG - Exonic
1098369206 12:69739116-69739138 CCTGCCGCGGCCGCCCCTCCTGG - Intronic
1102074353 12:110048219-110048241 GGTGCAGGTGAGGCCCCTCAGGG - Intronic
1104953553 12:132453230-132453252 GCAGCGTGTGAGGCCCCTCCGGG - Intergenic
1105004102 12:132710580-132710602 GCTTCCGGTGCGGAACCTTCTGG + Intergenic
1105016867 12:132791496-132791518 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1105016874 12:132791537-132791559 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1105016905 12:132791745-132791767 TCTGCAGATGTGGCCCCTCCTGG - Intronic
1105016912 12:132791786-132791808 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1105378500 13:19864748-19864770 GCACCCGCTGCGGCCCCTGCGGG + Intergenic
1107603814 13:42040166-42040188 GCTGCAGGCGCCTCCCCTCCTGG - Intronic
1108893067 13:55286739-55286761 GCTACAGGTGCAGCCACTCCTGG + Intergenic
1110630336 13:77698660-77698682 CCTGCTGGGTCGGCCCCTCCGGG - Intronic
1113924834 13:113935616-113935638 GCTGCCAGTTTGGCCCTTCCAGG - Intergenic
1115892229 14:38044099-38044121 GCTGCTGGAGAGTCCCCTCCAGG - Intergenic
1118463921 14:66013819-66013841 GCGGCAGCTGCGGCTCCTCCCGG + Intergenic
1118597414 14:67446591-67446613 GGTGACTGTGCTGCCCCTCCTGG - Intergenic
1118667802 14:68089268-68089290 GCTGACGGTGTTGTCCCTCCTGG + Intronic
1118992462 14:70809110-70809132 GCCGCCGCTGCCGCCCCGCCGGG - Exonic
1121018156 14:90561220-90561242 GCTGCCGGCCCAGCCCCTCGGGG - Intronic
1121377889 14:93430765-93430787 GCTTCCTGTCCGTCCCCTCCTGG - Intronic
1122786917 14:104168134-104168156 GCTGCCCAGGAGGCCCCTCCAGG - Intronic
1122881956 14:104694163-104694185 ACCGCCCGTGTGGCCCCTCCTGG - Intronic
1124024782 15:25955298-25955320 AGTGCCGGTGCTGCCTCTCCTGG - Intergenic
1124405636 15:29389387-29389409 GAAGCCTGTGCTGCCCCTCCTGG - Intronic
1127071171 15:55289665-55289687 GCGGCGGGTCCGGTCCCTCCGGG - Intronic
1127855834 15:62953120-62953142 GCGGCAGCTGCGGCTCCTCCTGG - Intergenic
1129853771 15:78810600-78810622 GCTGCTGGCGCGGCCCCTGGCGG - Intronic
1130093860 15:80841686-80841708 GCTGCCGGAGCCCTCCCTCCAGG + Intronic
1130234903 15:82124825-82124847 GCTGCCTGTGCTGCCCCACGTGG + Intergenic
1131091861 15:89629540-89629562 GCTGCTGGTGCTGCTCCTCTCGG + Exonic
1132588344 16:715728-715750 GCGGCCGGTGCGGCCCTTCGCGG + Exonic
1132692280 16:1186983-1187005 GCGGCTGGCCCGGCCCCTCCTGG + Intronic
1132703001 16:1229915-1229937 GCTGCTGGCGCTGCCCGTCCTGG - Exonic
1132705322 16:1240953-1240975 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132708451 16:1256316-1256338 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132729155 16:1352095-1352117 CCTGCCGGCGCGGGCCCTACGGG - Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132879513 16:2155822-2155844 GCTGGCGGCGCTGCCGCTCCCGG + Exonic
1133052292 16:3124131-3124153 GCTGTCGGCGCTGCCCCTCTGGG + Intergenic
1133227835 16:4351050-4351072 GCCGCCGGTGCCGCCGCTGCCGG + Intronic
1133232853 16:4374564-4374586 GCGGCCGCTGGGGCCCCTGCTGG + Intronic
1133271935 16:4614564-4614586 GCCGGCTGTGCGCCCCCTCCGGG - Intronic
1136573318 16:31109265-31109287 GCTTCCGCTCCGGCCCCTCCTGG + Exonic
1138360769 16:56425506-56425528 GCTCCCGCTGCTGCCCCTGCCGG + Exonic
1139952772 16:70680118-70680140 GCGGCCGGGGCGCCCCCTCCTGG - Intronic
1140193576 16:72838353-72838375 GCTGCGTGTTCGGCCCCTGCTGG + Intronic
1141620912 16:85236046-85236068 GGGGCTGGTGCCGCCCCTCCCGG + Intergenic
1141727557 16:85799765-85799787 GTGGCCGGTGCGGCGCCGCCAGG + Exonic
1141831770 16:86513087-86513109 GCTGCCGCCGCAGGCCCTCCTGG + Exonic
1141861575 16:86720282-86720304 GCTGCAGGTGCAGCCTCTCCTGG + Intergenic
1142762679 17:2051028-2051050 GCGGGTGGGGCGGCCCCTCCGGG - Intergenic
1143880570 17:10026593-10026615 GCTGGCAGTGGGGCCACTCCTGG - Intronic
1143965110 17:10751437-10751459 GCTGCCAGTCCCTCCCCTCCAGG - Intergenic
1144971264 17:19111197-19111219 GCCTCCGGCGCGCCCCCTCCCGG + Intergenic
1144991570 17:19237368-19237390 GCGTCCGGCGCGCCCCCTCCCGG + Exonic
1145141370 17:20450907-20450929 GGTGCGGGTGTGGCCTCTCCAGG - Intronic
1145773518 17:27510252-27510274 GGTGGCGGTGCTGCCCCACCAGG + Intronic
1146514822 17:33480834-33480856 GCTGCAGGTGGAGCCTCTCCTGG - Intronic
1147686286 17:42288577-42288599 CCGGACGGTGCGGCCCCACCAGG + Exonic
1147717399 17:42517622-42517644 GGTGCTTGTGCGCCCCCTCCTGG + Intronic
1150790422 17:68197542-68197564 CCTGCCGGCTCGGCCCCCCCCGG + Intergenic
1151349057 17:73520752-73520774 GCTGCTGCTGGAGCCCCTCCAGG - Intronic
1151370872 17:73645326-73645348 GCCGCCGCCGCCGCCCCTCCCGG - Intergenic
1152069145 17:78126545-78126567 GCTGCAGCTCCAGCCCCTCCTGG + Exonic
1152926176 17:83088776-83088798 CCTGCCGATGAGCCCCCTCCAGG + Intronic
1154097656 18:11432723-11432745 GCTGCCTGTGGGACCCCTCTGGG - Intergenic
1155264349 18:24076465-24076487 GCTGCTGGAGCGGCCCCTGTAGG + Intronic
1157304741 18:46508760-46508782 GCTGCAGATGAGGCTCCTCCTGG + Intronic
1160390487 18:78527662-78527684 CCTGCCTGTGTGGCCCCGCCTGG + Intergenic
1160792579 19:929444-929466 GCGGCGGGGGCGGCCCCTGCGGG - Exonic
1160793260 19:932662-932684 GCTACGTGGGCGGCCCCTCCGGG - Exonic
1160937448 19:1603717-1603739 GTAGCCAGTGCAGCCCCTCCCGG - Intronic
1161739908 19:6014678-6014700 TCTGCAGGGGAGGCCCCTCCAGG + Intronic
1162496023 19:11023880-11023902 GGTGCCTGTGCGGGCTCTCCTGG + Intronic
1162808982 19:13153133-13153155 GCTGCCTGTTCTGTCCCTCCCGG + Exonic
1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG + Exonic
1163666229 19:18605348-18605370 GCTGCCTGTAGGGCTCCTCCGGG - Intronic
1163698501 19:18775726-18775748 GCTGCCCGTGAGGCCCATCATGG - Exonic
1167659899 19:50790468-50790490 GCTGCTGGTGCTGCCACCCCGGG + Exonic
1168268929 19:55239276-55239298 CCTGCAGCTGTGGCCCCTCCTGG - Intronic
1168482884 19:56736371-56736393 GCTTCCCCTGCGGCCCCTCTTGG + Intergenic
1202704641 1_KI270713v1_random:13870-13892 CCTGCCGCTGCTGGCCCTCCAGG + Intergenic
925910538 2:8570840-8570862 GCAGCCGGTGCGGACCATTCAGG + Intergenic
926251754 2:11158934-11158956 GCAGCCGTTGCTGCCCCTGCAGG - Intronic
927606600 2:24491614-24491636 GCTGCGGGTGCGGAGCCTCCCGG + Intergenic
932251504 2:70248438-70248460 GCTGTCGCGGCGGCGCCTCCAGG + Exonic
933666913 2:84971417-84971439 GGTGGCGGCGCGGCCCCTCCCGG - Exonic
936661342 2:114547310-114547332 GCTGCTGCTGCTGCCCCTGCAGG + Intronic
937912013 2:127080347-127080369 GCTGCTGGGCCAGCCCCTCCTGG - Intronic
939612937 2:144332305-144332327 GCCGCCGCTGCTGCCCCTCTGGG + Intronic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
947749561 2:232525353-232525375 GCTGCTGGTGCAGGCCCTGCAGG + Exonic
947800642 2:232927321-232927343 GCAGCCAGCGCCGCCCCTCCCGG + Intronic
947888568 2:233595711-233595733 GCTGCAGGGGCGGCCCCTCATGG + Intergenic
948479122 2:238239511-238239533 GCTGACGGTGCGGCGGGTCCAGG - Exonic
948884246 2:240874980-240875002 GCAGCTGGGGCGGGCCCTCCTGG + Intronic
948902505 2:240963639-240963661 CCTCCCTGTGCAGCCCCTCCCGG - Intronic
1171458074 20:25283043-25283065 TCTGCTTGTCCGGCCCCTCCGGG - Intronic
1172163853 20:32886792-32886814 CCTGCCAAAGCGGCCCCTCCAGG - Intronic
1174138637 20:48397881-48397903 GCTGCTGGTGCTGCCGCTCTTGG - Intergenic
1175036246 20:56004093-56004115 GCTGCCGGGGCTGCCCGTCTGGG - Exonic
1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG + Exonic
1175915362 20:62423471-62423493 GCTGCAGCTCCGCCCCCTCCTGG - Intronic
1176122738 20:63461522-63461544 GCTGCAGTTGCGGCTCCTCGTGG - Intronic
1176171529 20:63698473-63698495 GCTGCTGGTGCGGCTGCTGCAGG + Exonic
1176249875 20:64115465-64115487 CCTGCCAGTGCTGCCTCTCCTGG - Intergenic
1176520047 21:7817672-7817694 TCTGCTGGGGCAGCCCCTCCGGG + Exonic
1178534968 21:33403595-33403617 GCCGCCGCCGCGGCCCCGCCAGG + Exonic
1179543545 21:42099991-42100013 GCAGCCGGTGTGGCCCATCTGGG + Intronic
1179923561 21:44520577-44520599 GCTCCTGGTCCGGCCCCTGCGGG + Intronic
1180590524 22:16933442-16933464 GCTGCCCCTGCTGCTCCTCCTGG - Intergenic
1180840293 22:18955947-18955969 GCTGGCCGTGTGTCCCCTCCAGG + Intergenic
1181370364 22:22410336-22410358 GCTGCCGGGGCTCACCCTCCTGG - Intergenic
1182146767 22:28001511-28001533 GCTGCCGGTGCCGGCCCACGGGG + Exonic
1183368673 22:37420173-37420195 GGTGGCGGTGCGGCCCCGGCGGG + Intronic
1183942068 22:41301613-41301635 GCTGCCGGGGCGGCGGCGCCGGG + Exonic
1184714612 22:46273782-46273804 GCTGCCTGGCTGGCCCCTCCTGG + Intronic
1184759594 22:46537125-46537147 GCTGCCCGTGCTGCTGCTCCTGG - Exonic
1185259364 22:49853318-49853340 GCTCCCCGCGCGGCCCCCCCGGG - Intergenic
1185322770 22:50209495-50209517 GCTGCCCCAGCGGCTCCTCCCGG - Intronic
1185362042 22:50414260-50414282 GCAGCCTGTGCTGCCCCACCTGG + Intronic
950509830 3:13419697-13419719 GCTGCCCCGGCGCCCCCTCCCGG + Intronic
953458570 3:43063186-43063208 GCTGGAGGGGCTGCCCCTCCTGG + Intergenic
953905781 3:46867660-46867682 CCTGCCGGTCCCGCCCCTCCTGG + Intronic
954302116 3:49705562-49705584 GCTGCTGGGGCGGCCCCCCGAGG + Exonic
954371511 3:50171611-50171633 GCTGCCAGTGGAGCCCCCCCAGG - Intronic
954459426 3:50617816-50617838 GCTTCCGCTGTGGACCCTCCAGG - Intronic
956406371 3:68932504-68932526 GCAGTCGGTGCGCCCCGTCCAGG + Exonic
956406388 3:68932574-68932596 GCGGCGGGCCCGGCCCCTCCTGG - Exonic
961537495 3:127578954-127578976 GCTTCCGGTGCGGGCTGTCCTGG - Intronic
963253406 3:143121246-143121268 GCGGGGGTTGCGGCCCCTCCAGG + Exonic
964801581 3:160564868-160564890 GCGGCCGGTGCTGCCCCGGCCGG - Intronic
966378930 3:179323701-179323723 GCTGGCGCTGCGGCCCTGCCCGG + Intronic
966918702 3:184598697-184598719 GCTGCCGGTTCAGCCGCTGCAGG - Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
967883272 3:194316247-194316269 GATGCCGATGCTGCCGCTCCGGG + Intergenic
967890595 3:194361666-194361688 GCCGCCGCTGCTGCACCTCCCGG - Intronic
967946910 3:194811290-194811312 CCTGCCCGTGGGGCCCGTCCTGG - Intergenic
968079397 3:195835834-195835856 GCTGCCAGTGAGGGCCCTGCTGG - Intergenic
968498466 4:932049-932071 GCTGCGGGTGCGGCGGGTCCTGG - Exonic
968562210 4:1290044-1290066 CCTCCCGGGGCGGCCCCTCGCGG - Intronic
968661170 4:1799405-1799427 GCAGCCGCTGGGGCCCCACCAGG - Exonic
968955493 4:3716793-3716815 GCAGTCGGTGGGGGCCCTCCAGG + Intergenic
969294059 4:6258986-6259008 GCTGCCTCTGAGGCCCCTCTGGG - Intergenic
969396456 4:6924736-6924758 GCTGAAGGCGCGGCCCCCCCAGG - Intronic
973246563 4:48016673-48016695 GCTGGCGCTGAGGCCCCGCCTGG + Intronic
975028062 4:69576596-69576618 GCTGCTGGTGCCGCCCGCCCTGG - Intergenic
975683389 4:76897495-76897517 GCTGCTGGGGCGGCTCCCCCCGG + Exonic
975920432 4:79380178-79380200 TGTGCCTGTGCTGCCCCTCCCGG + Intergenic
975992002 4:80267072-80267094 GCTGCCGGTCCGGCGCCCCGAGG - Exonic
976897371 4:90128114-90128136 GCGGCCGCGGCGGCCGCTCCAGG + Intronic
977410162 4:96652950-96652972 GCTACAGGTGAGGCACCTCCAGG + Intergenic
986184498 5:5422993-5423015 GCAGCAGGTGCAGCACCTCCCGG + Exonic
989368310 5:40680027-40680049 GCTGCCGCTGAGGCCGCTCCTGG - Exonic
994637671 5:102363328-102363350 GCTGCAGGGGCGGGCCCTCGGGG - Intergenic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
997840631 5:137236211-137236233 GCTGCCAGTGAGGGCCCTCTAGG + Intronic
998119204 5:139561917-139561939 GCTGCCGGTGCTGGCCCCTCGGG + Intronic
999139081 5:149345569-149345591 GCTGCGGGTGCAGCGCCTACTGG + Exonic
999366580 5:151027556-151027578 GCTGGGGCTGCAGCCCCTCCTGG + Intronic
999868628 5:155728278-155728300 GCTGCCGCTGCTGCCGCTGCCGG + Intergenic
1001396237 5:171420989-171421011 GCTGCCCGCGAGGCCGCTCCCGG + Intronic
1002060080 5:176620784-176620806 GCTGCTGGTGGGGGCTCTCCTGG + Exonic
1002103856 5:176870287-176870309 TCTGCCAGTGTGGCCCCTCTGGG - Intronic
1002181683 5:177434069-177434091 GCTCCCGGTGCAGGTCCTCCAGG - Exonic
1004864434 6:19838445-19838467 GTAGCCGGGGGGGCCCCTCCGGG - Intronic
1006154236 6:32005706-32005728 GCTGCTGCTGCTGCCCCTGCTGG + Intergenic
1006160540 6:32038440-32038462 GCTGCTGCTGCTGCCCCTGCTGG + Exonic
1006162963 6:32048612-32048634 ACTGCCGGTGGAGCCCCGCCTGG - Intronic
1006180419 6:32150627-32150649 GCTGCCGGGGCACCCCCACCCGG - Exonic
1007161077 6:39792345-39792367 GCCGCGGCTGCCGCCCCTCCAGG - Intronic
1007744414 6:44034652-44034674 GCTGCCGGTGCATGCCATCCTGG - Intergenic
1011044633 6:83067906-83067928 GTTGCCGCTCCGGCCCCGCCAGG + Intronic
1013366229 6:109440515-109440537 GCTGCCGGAGCGGCCGCTGCAGG - Exonic
1014632529 6:123803895-123803917 GCTGCCGCTGCTGCCCCTGCGGG + Intergenic
1014947661 6:127516265-127516287 GCTCCCGGAGCGGCCCCTTTGGG + Exonic
1017546483 6:155456800-155456822 GCTTCCCGTGCAGCCACTCCTGG - Intergenic
1019100382 6:169625096-169625118 GCTGCTGGCGCGGACACTCCAGG - Intronic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1019292832 7:258699-258721 GCTGCAGGTACAGCCCCTGCCGG + Exonic
1019414755 7:922135-922157 GGTGTCAGTGCGGCCCCTCCAGG - Intronic
1019453654 7:1113372-1113394 GCTGCCCGGGCGGCGCCTTCTGG - Intronic
1020105730 7:5421429-5421451 GCCGGCGGTGGGGCCCCTCCGGG + Exonic
1021827986 7:24573546-24573568 GCCGCCGCTGCCGCCGCTCCCGG - Exonic
1022795628 7:33729458-33729480 GCAGCTTGTGCGGCCGCTCCAGG - Intergenic
1023678006 7:42650942-42650964 GCTGCCTGTGCATCCCCTGCTGG - Intergenic
1024202698 7:47122607-47122629 GCTCCCGATGCAGCCCCTTCAGG - Intergenic
1029496031 7:100895821-100895843 GCTCCCGGCGCGGCCCGGCCCGG - Exonic
1031145530 7:117993605-117993627 GCTGCTGCTGCTGCCCCTACAGG - Intergenic
1033301749 7:140192392-140192414 TCTGCCTCTCCGGCCCCTCCTGG - Intergenic
1034129021 7:148698901-148698923 GCTACCGGGGCTGCCCCGCCTGG - Exonic
1034467337 7:151237829-151237851 GCAGCTGGTGCTGCCACTCCTGG + Exonic
1035662401 8:1358050-1358072 GCTGCCTGTGCCCCCACTCCTGG - Intergenic
1035685841 8:1523085-1523107 ACTGCCCGTGCGGCATCTCCTGG + Intronic
1037803589 8:22048060-22048082 GCGGCAGGGGCGGCCCCGCCAGG + Exonic
1040789199 8:51205592-51205614 GCAGCCGGTGCTGCACCTCAAGG - Intergenic
1041690004 8:60679110-60679132 GCCGCCGCCGCCGCCCCTCCCGG - Intronic
1043472590 8:80578039-80578061 GCGGCCGGCGCCTCCCCTCCGGG + Intergenic
1049318289 8:141981312-141981334 GCTTCCGATGCCACCCCTCCAGG - Intergenic
1049665464 8:143840873-143840895 GCCGCCGGCGCAGCCTCTCCCGG + Exonic
1049849126 8:144821383-144821405 GCTGCCAGAGAGGCCCCACCAGG + Intergenic
1050472620 9:6008214-6008236 GCCGCCGCTGCGGCCCCCTCCGG - Intergenic
1051433730 9:17007747-17007769 CCTGCCTGTGCAGCCCATCCAGG - Intergenic
1052414221 9:28157149-28157171 GCTGCAGGAGCGGGCCCTCATGG - Intronic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1056985588 9:91361640-91361662 GCTGCGGGTGCGGCACCTGGAGG - Exonic
1058885780 9:109320500-109320522 GCTGCCGCTGCGCCGCCGCCCGG + Exonic
1058912581 9:109534362-109534384 GCGGCAGCTGCGGCTCCTCCCGG + Intergenic
1061618696 9:131796756-131796778 GCTGTCGGTGGGGGGCCTCCTGG - Intergenic
1185835855 X:3345749-3345771 GCTGCCCGCCCGGCCACTCCAGG - Intronic
1190690173 X:52907399-52907421 GCTGGCGGAGCAGCCCCTCTGGG - Exonic
1190695810 X:52948393-52948415 GCTGGCGGAGCAGCCCCTCTGGG + Exonic
1194977292 X:100408561-100408583 GCTGCCGGTGCTGCTGCTGCTGG - Exonic
1198312233 X:135434594-135434616 GCTGGCGCCGCAGCCCCTCCTGG - Intergenic
1199520154 X:148726176-148726198 GCTTGCTGTGCGGCCCCTCATGG - Intronic
1199709835 X:150461193-150461215 GCTGCAAGTGTGGCACCTCCAGG - Intronic
1199772827 X:150984699-150984721 GCTCCCGGTCCCGCCCCGCCCGG + Intronic
1199843262 X:151672209-151672231 GCTGCCGCTGCTGCTCCTTCAGG - Exonic
1201179758 Y:11333128-11333150 GCTGCGGGTCCGGGTCCTCCCGG - Intergenic