ID: 1175893160

View in Genome Browser
Species Human (GRCh38)
Location 20:62324180-62324202
Sequence CTGCCAGCACAACACCGAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175893160_1175893168 9 Left 1175893160 20:62324180-62324202 CCCCTTCGGTGTTGTGCTGGCAG 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1175893168 20:62324212-62324234 AGAGTGGACAGTCAGAGCTATGG 0: 1
1: 0
2: 1
3: 16
4: 208
1175893160_1175893169 12 Left 1175893160 20:62324180-62324202 CCCCTTCGGTGTTGTGCTGGCAG 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1175893169 20:62324215-62324237 GTGGACAGTCAGAGCTATGGTGG 0: 1
1: 0
2: 1
3: 6
4: 127
1175893160_1175893166 -7 Left 1175893160 20:62324180-62324202 CCCCTTCGGTGTTGTGCTGGCAG 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1175893166 20:62324196-62324218 CTGGCAGTCCTGGGGCAGAGTGG 0: 1
1: 1
2: 2
3: 46
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175893160 Original CRISPR CTGCCAGCACAACACCGAAG GGG (reversed) Exonic
900218792 1:1496037-1496059 CTGCCAGGACTAGACAGAAGTGG + Exonic
903219659 1:21862091-21862113 ATGCCAGCACAACGCCGCAGGGG - Exonic
907424514 1:54371065-54371087 CTGCCAGAAGACCACCCAAGGGG + Intronic
909098649 1:71322358-71322380 CTTCCAGTACAACACTGAAGAGG - Intergenic
1065818488 10:29503884-29503906 TAGCCAACACAACACTGAAGGGG + Intronic
1067052149 10:43027837-43027859 CTGCCAGCACAGCAGGAAAGTGG + Intergenic
1067854685 10:49782061-49782083 AAGCCTGCACAACACGGAAGGGG - Intergenic
1069860899 10:71471229-71471251 CTCCCACCACAACACTGACGTGG + Intronic
1072296554 10:94014080-94014102 CAGCCAGCTCAAAACTGAAGAGG + Intronic
1076396623 10:130142945-130142967 GTGCCAGCACCACACCGCAAAGG - Intronic
1076893854 10:133299154-133299176 CTGGCAGCACAACTCCCACGTGG + Intronic
1077131029 11:972794-972816 CTGCCAGCAAAACCAAGAAGGGG + Intronic
1086345308 11:85890234-85890256 CTGACAGCAGAACACAGAAGAGG + Intronic
1088597678 11:111452148-111452170 CTGTCAGCACAACATCCAAGAGG + Intronic
1095634293 12:44414254-44414276 TTGCCAACACAATACTGAAGAGG + Intergenic
1097082411 12:56442331-56442353 CTGCCAGTGCAAAACCAAAGAGG + Intronic
1097186872 12:57200784-57200806 CTGCCAGGACAACAGTGACGAGG + Exonic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100009085 12:89932109-89932131 CTAGCAGCACAACACTGAAAAGG + Intergenic
1106550545 13:30767283-30767305 CTGCCTGCACTCCACGGAAGGGG + Intergenic
1108389702 13:49936209-49936231 CAGGCAGCACAACACCGAGGTGG + Exonic
1109932644 13:69235510-69235532 CTGCCAGTAAAACATCCAAGTGG + Intergenic
1110657506 13:78017935-78017957 CAGCCAGCATAACACTGAATAGG - Intergenic
1117153373 14:52912062-52912084 CTGGCAGCACGACAGGGAAGGGG - Intronic
1117660755 14:58001868-58001890 CTGCCAGCATCCCACCGCAGGGG - Exonic
1125506006 15:40267994-40268016 CTGCCAGCACCCCACAGCAGGGG + Intronic
1128790788 15:70432080-70432102 CTCCCACCACAACACAGAAAGGG + Intergenic
1130147213 15:81283129-81283151 CTGCCAGGACCAGACCGAGGTGG + Intronic
1130807337 15:87338750-87338772 CTTCCAGCACAATACTGAATAGG - Intergenic
1137961660 16:52887442-52887464 CTGCCAGAACAAGACCCATGAGG - Intergenic
1138071292 16:53995551-53995573 CTGCCAGCATAACACTGGTGTGG - Intronic
1139060246 16:63241634-63241656 GTTCCTGTACAACACCGAAGGGG + Intergenic
1140974444 16:80045448-80045470 CTGCCATCACAACACTAAACAGG + Intergenic
1142260798 16:89041704-89041726 CTGCCAGGAAGACACCGACGTGG - Intergenic
1143450858 17:7036070-7036092 CTCCCAGCCGAACACCGAACCGG + Exonic
1146830649 17:36066350-36066372 CTGCCTGCCCAACACTGAACAGG - Intronic
1150136230 17:62696849-62696871 CTGCCAGCACACCTTCGAGGAGG - Intergenic
1155393886 18:25366325-25366347 GTGCCAGCACACCACCAAAGAGG + Intergenic
1156241882 18:35262725-35262747 CTGCCAGCTCAGCACTGCAGTGG + Intronic
1157210287 18:45736334-45736356 GTGCCAACACAACACGTAAGGGG + Intronic
1160555684 18:79723513-79723535 CTGCCAGCCCAGCACCAAAAAGG - Intronic
927547291 2:23965239-23965261 CTTCCAGTACAACACTGATGAGG + Intronic
929100609 2:38308886-38308908 CTGCCAGAACAAGACCGCTGTGG - Intronic
934772990 2:96919862-96919884 CTGCCTGCTCAGCACTGAAGCGG + Intronic
937707656 2:124939900-124939922 CTGGCAGCAGACCACCGAACAGG - Intergenic
938070013 2:128303338-128303360 CTAACAGCACAACACCCATGGGG + Intronic
938833398 2:135074818-135074840 CTGGCAGCACAGCAGAGAAGGGG + Intronic
938985945 2:136576322-136576344 GTGCCAGCACACCACTGAAGGGG + Intergenic
947743368 2:232495189-232495211 CTGACAGCAGAACCCCAAAGTGG - Intergenic
948247897 2:236501786-236501808 CTGCCAGGACAACATTCAAGAGG + Intronic
1175893160 20:62324180-62324202 CTGCCAGCACAACACCGAAGGGG - Exonic
1175897781 20:62346994-62347016 CTGCCAGCACAACACCTGCGGGG - Exonic
1176173445 20:63706928-63706950 CTGACAGCACAAAACCGAAGGGG + Intronic
1177706354 21:24710777-24710799 CTTCCAGTACTACACCGAATAGG - Intergenic
1181093296 22:20489046-20489068 CCACCAGCACAACATCGAAGAGG + Exonic
1181270883 22:21657858-21657880 CTGCCAGCAGATCTCCGAGGAGG + Intronic
949972133 3:9417320-9417342 GTGCCAGCACAACAAAAAAGAGG + Intronic
951260348 3:20500339-20500361 CAGCCAGCATAACATCGAATGGG - Intergenic
952383043 3:32818911-32818933 CTGCCAGCACCACGACGACGAGG + Exonic
954460203 3:50622156-50622178 CTCAAAGCACAACACAGAAGAGG + Intronic
956010493 3:64826093-64826115 TTAACAGCAAAACACCGAAGTGG - Intergenic
957290181 3:78269046-78269068 CTGCCACCACCAGACCAAAGAGG - Intergenic
960650678 3:119945072-119945094 CTGCCAGAACAATTCAGAAGTGG + Intronic
961819054 3:129565984-129566006 CTGCCGGCCCAACATGGAAGAGG - Exonic
961963675 3:130880008-130880030 CTGCCACCACCACACCAAATAGG - Intronic
970686872 4:18578334-18578356 GTGCCAGGAAAACACAGAAGAGG + Intergenic
984277508 4:177627697-177627719 CAGGCAGCACAGCAGCGAAGGGG + Intergenic
989658234 5:43768460-43768482 CTTCAAGTAGAACACCGAAGAGG - Intergenic
990374668 5:55157334-55157356 CTGCCAAAACAACAAAGAAGAGG + Intronic
993075823 5:83229277-83229299 CTGCCAGCACAATGCCTGAGAGG - Intronic
994659296 5:102634307-102634329 CTTCCAGTACTACACTGAAGAGG - Intergenic
997654183 5:135543638-135543660 CAGCCAGAGCAAAACCGAAGTGG - Intergenic
1003173600 6:3738669-3738691 CTGCCTGGACAAAACCAAAGTGG + Intronic
1003976317 6:11347825-11347847 CAGCCAGCACATCACTGAATGGG + Intronic
1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG + Intronic
1007320978 6:41028564-41028586 CTGCCAGCGCAGCCCCGCAGCGG - Exonic
1009735100 6:67666363-67666385 CTGTCAGCAGAACAGTGAAGAGG + Intergenic
1015634665 6:135263666-135263688 CTGGAAACACAACAACGAAGAGG - Intergenic
1019818771 7:3222789-3222811 TTGCAAGAACAGCACCGAAGGGG - Intergenic
1026265856 7:68795542-68795564 ATGCCAGCACAACACAGATCTGG + Intergenic
1029588803 7:101493323-101493345 CTGCCAGGCAAACACTGAAGGGG - Intronic
1034943050 7:155244412-155244434 CACACAGCACAACACGGAAGAGG + Intergenic
1035140864 7:156759283-156759305 CTGTAAGCAGAACACAGAAGTGG + Intronic
1047422436 8:124718320-124718342 AGGCCAGCACAACATCAAAGAGG + Intronic
1049230061 8:141477329-141477351 CTGCCAGCTCCAAACCCAAGTGG + Intergenic
1050608758 9:7329323-7329345 CTGACAGCAGAAAACCCAAGAGG - Intergenic
1053394192 9:37757679-37757701 CTGTAAGAACAACACTGAAGGGG + Intronic
1055568779 9:77595309-77595331 GTGCCTGCTCAACACCAAAGAGG + Intronic
1057756210 9:97838726-97838748 CTTCCAGTACAACACTGAATAGG + Intergenic
1187496621 X:19801265-19801287 CTGCCAGAACAACACGGTGGGGG + Intronic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1191783000 X:64888640-64888662 CTTCCAGCACTACATCGAATAGG - Intergenic
1194744217 X:97610762-97610784 CTGCCAACAGAACACTGAAGAGG - Intergenic
1195713288 X:107792795-107792817 TTGCCACTACAACACCCAAGAGG - Intronic
1198326257 X:135576629-135576651 CTGCCTGCCCAGCACCAAAGTGG + Intronic