ID: 1175893633

View in Genome Browser
Species Human (GRCh38)
Location 20:62326568-62326590
Sequence CTGTTTTCCACCACGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175893620_1175893633 7 Left 1175893620 20:62326538-62326560 CCCAGCCCCCACCCCGCTTCTGC 0: 1
1: 0
2: 4
3: 67
4: 676
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893629_1175893633 -5 Left 1175893629 20:62326550-62326572 CCCGCTTCTGCTCCTGGGCTGTT 0: 1
1: 1
2: 0
3: 37
4: 406
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893627_1175893633 -1 Left 1175893627 20:62326546-62326568 CCACCCCGCTTCTGCTCCTGGGC 0: 1
1: 0
2: 3
3: 35
4: 398
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893619_1175893633 8 Left 1175893619 20:62326537-62326559 CCCCAGCCCCCACCCCGCTTCTG 0: 1
1: 1
2: 7
3: 97
4: 990
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893618_1175893633 11 Left 1175893618 20:62326534-62326556 CCTCCCCAGCCCCCACCCCGCTT 0: 1
1: 1
2: 26
3: 236
4: 1866
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893630_1175893633 -6 Left 1175893630 20:62326551-62326573 CCGCTTCTGCTCCTGGGCTGTTT 0: 1
1: 0
2: 4
3: 36
4: 335
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893625_1175893633 0 Left 1175893625 20:62326545-62326567 CCCACCCCGCTTCTGCTCCTGGG 0: 1
1: 0
2: 5
3: 28
4: 318
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893621_1175893633 6 Left 1175893621 20:62326539-62326561 CCAGCCCCCACCCCGCTTCTGCT 0: 1
1: 0
2: 7
3: 95
4: 870
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893622_1175893633 2 Left 1175893622 20:62326543-62326565 CCCCCACCCCGCTTCTGCTCCTG 0: 1
1: 1
2: 4
3: 49
4: 563
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893628_1175893633 -4 Left 1175893628 20:62326549-62326571 CCCCGCTTCTGCTCCTGGGCTGT 0: 1
1: 0
2: 0
3: 27
4: 283
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117
1175893623_1175893633 1 Left 1175893623 20:62326544-62326566 CCCCACCCCGCTTCTGCTCCTGG 0: 1
1: 0
2: 5
3: 67
4: 730
Right 1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG 0: 1
1: 0
2: 1
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175893633 Original CRISPR CTGTTTTCCACCACGGAGAA TGG Intronic
900235803 1:1589803-1589825 CTGTTTTCCACCAGGGTCCATGG - Intergenic
902778664 1:18690699-18690721 CTAATTTCCACCATGGAGACTGG - Intronic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
906960155 1:50415372-50415394 CTCTTTTCCTCCTGGGAGAAGGG - Intergenic
907154138 1:52316928-52316950 CTCTTTTACACCACAGAAAATGG - Intronic
907818740 1:57946149-57946171 CTGTTTTCCACCTCCCAGCATGG + Intronic
913330661 1:117664522-117664544 CTTTCTTCAACCACGTAGAATGG - Intergenic
917782480 1:178412895-178412917 CATTTTTCCAGCAGGGAGAAGGG + Intronic
917787380 1:178473192-178473214 AAGCTTTCCATCACGGAGAATGG + Exonic
918980562 1:191552777-191552799 TTGATTACCACCAAGGAGAATGG - Intergenic
921139773 1:212296194-212296216 ATGTGTCCCACCACCGAGAAAGG + Intronic
921889751 1:220342014-220342036 CTGTTCTCCAACCCGGAGGAAGG - Intergenic
922548397 1:226475614-226475636 CTGTTGTCCACCTGGGACAAAGG + Intergenic
923189205 1:231604107-231604129 CTTTTTTCCTCTAGGGAGAAGGG - Intronic
924754425 1:246928689-246928711 CTGAATTCCACCACAGAAAATGG + Intronic
1063252422 10:4287821-4287843 CTATATTCCACCCCAGAGAAAGG + Intergenic
1064766850 10:18683949-18683971 CTGTTCACTACCAGGGAGAAAGG + Intergenic
1069515035 10:69070588-69070610 CTGGGTCCCACCAGGGAGAAGGG - Intergenic
1076136801 10:128050718-128050740 CTGTCTTCCACCACCTAGGAAGG + Intronic
1084308689 11:68303077-68303099 ATCTTTGCCACCATGGAGAAAGG - Intergenic
1087220812 11:95544427-95544449 CTGTCTTCTACCACAAAGAAGGG - Intergenic
1088121038 11:106369785-106369807 CTGTTTTCCACATTGGAAAATGG + Intergenic
1089261168 11:117224924-117224946 CTGTTTTCCACTTTGGAGAGGGG - Intronic
1090473057 11:126997023-126997045 CTGATCTCCACCTCGGAGACAGG - Intronic
1092960312 12:13590886-13590908 TTGTTTTCTACCACAGAGATGGG + Intronic
1093911652 12:24754720-24754742 ATGTGTTCCACCACAGAGAACGG - Intergenic
1095839769 12:46680395-46680417 TTATTTTCCACCATGCAGAAGGG - Intergenic
1097830458 12:64218968-64218990 TTGTTTTCCAGCATGAAGAAAGG - Intronic
1098422189 12:70310816-70310838 CTGTTTTCCACATAGGAGTAAGG + Intronic
1100432923 12:94546541-94546563 CTTTTTTCCCCCTCAGAGAAGGG - Intergenic
1100808059 12:98308496-98308518 CTGGTTACCACTAAGGAGAAAGG + Intergenic
1105346708 13:19579539-19579561 CTGTATTCCAACTAGGAGAAAGG - Intergenic
1112826144 13:103394254-103394276 GTGTTTTACATCACAGAGAATGG - Intergenic
1114482979 14:23046941-23046963 GTATTTTCCCCCAAGGAGAAAGG + Intergenic
1115565632 14:34622723-34622745 CTGCTTTCCAACAGGGAGGATGG - Intronic
1121027921 14:90630059-90630081 CTGTCTCCAACCCCGGAGAAAGG + Intronic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1122112367 14:99511328-99511350 TTTTTTTCCTCCAGGGAGAAGGG + Exonic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1129711531 15:77822713-77822735 CTGCTTTCCACCACAGAGGCTGG + Intergenic
1130990751 15:88874304-88874326 CTGGTTTCCACAAGGGAGAGAGG + Intronic
1131278825 15:91004876-91004898 CTTTTGTCCATCACTGAGAATGG - Exonic
1133485653 16:6215786-6215808 CTGTTTTCTTACATGGAGAAAGG + Intronic
1137367483 16:47873375-47873397 CTGTTTTCCCCCACCAATAATGG + Intergenic
1142882173 17:2890213-2890235 CTGTTTTCCAGCACTGAGACAGG - Intronic
1144184740 17:12786560-12786582 CTGCTTTCTACCCCGGGGAAGGG - Intergenic
1144371580 17:14596406-14596428 GTGTTTTGGACCACGAAGAAAGG - Intergenic
1149634644 17:58157026-58157048 CTGTTTTCGTCCAATGAGAAGGG + Intergenic
1149915417 17:60603938-60603960 CTATTTTCCCCCCCAGAGAAAGG + Intronic
1155495763 18:26440201-26440223 CTGTCCTCCACTAAGGAGAAAGG - Intergenic
1157029548 18:43889039-43889061 CTTTTTTTCCCCAGGGAGAAGGG + Intergenic
1157171683 18:45412608-45412630 CTGTTTACCCCCAGAGAGAAGGG - Intronic
1161785413 19:6322072-6322094 CTGTTTTCTTCAAAGGAGAAAGG + Intronic
1163262785 19:16201207-16201229 CTGTTTTCCAGCACCCAGAAAGG - Intronic
1164481348 19:28613358-28613380 CTGTTTTCCAACAGGGATCAAGG - Intergenic
925901605 2:8513125-8513147 TTGGTTTTCACCACGGGGAATGG - Intergenic
927200326 2:20574459-20574481 CTTTTTCCCACCACTGCGAAGGG + Intronic
939265314 2:139865260-139865282 AAGCTTTCCACCACGGAGAGGGG - Intergenic
940672836 2:156691383-156691405 CTGATTTCCACCACTGGTAAGGG + Intergenic
942220819 2:173767443-173767465 CTGTTTTCCACCGGGAAGACTGG - Intergenic
943480273 2:188408824-188408846 CAGTTTTACACCACTGTGAATGG - Intronic
945072173 2:206002940-206002962 CTTTTTTCCCCCCCAGAGAAGGG - Exonic
947143484 2:227041938-227041960 CTGCCTTCTACCAGGGAGAATGG - Intronic
1170159480 20:13297198-13297220 CTGTTTTCCAGAATGCAGAAGGG + Intronic
1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG + Intronic
1176288973 21:5034236-5034258 CTGTTTGCCGCCCAGGAGAAGGG + Intronic
1179868261 21:44229368-44229390 CTGTTTGCCGCCCAGGAGAAGGG - Intronic
1182653890 22:31874250-31874272 CTGGGTTCCAACACGGTGAACGG - Intronic
1183225368 22:36546316-36546338 CCGTTTGACGCCACGGAGAAAGG - Intergenic
1184119565 22:42441173-42441195 CTGGGGTCCCCCACGGAGAAGGG - Intergenic
950075551 3:10184406-10184428 CTGCTTTCCACAAGGGAGATAGG + Intronic
950845730 3:16014439-16014461 CTGTGTGCCACTACGGAAAATGG - Intergenic
957247480 3:77733242-77733264 CAGTTTTCGACCACTCAGAAAGG + Intergenic
957416016 3:79906060-79906082 CTGATTTCCAGCCCTGAGAAGGG + Intergenic
957543093 3:81601521-81601543 CAGTTTTCCACAACGTAAAATGG + Intronic
957608265 3:82432419-82432441 CTGTGTTCTCACACGGAGAAAGG + Intergenic
958538500 3:95435803-95435825 CTTTTTTACATCACGGAGGACGG - Intergenic
962603115 3:137010300-137010322 CTGTTTTCCGCCACGGACAAGGG + Exonic
965619957 3:170633508-170633530 CTTTTTTCCAGCAGGGAAAATGG - Intronic
967545036 3:190715449-190715471 CTGTTTTGGACCATGGAGCACGG + Intergenic
974325575 4:60410125-60410147 AGTTTTTCCACCAAGGAGAATGG - Intergenic
975841064 4:78474742-78474764 TTGTTTTTCACCACTGAGGATGG - Intronic
987106018 5:14640366-14640388 TTGTTTTGGACCACGGAGCATGG - Intergenic
987319225 5:16752188-16752210 CTGTTTCACACCACGAAGAATGG + Intronic
989749462 5:44875925-44875947 CTGTCTTCCATCCCAGAGAAAGG + Intergenic
991516525 5:67442492-67442514 CTTTTGTCCAACAAGGAGAAGGG + Intergenic
991675900 5:69089706-69089728 CTTTTTTCCAGCACGGATCAAGG + Intergenic
992406719 5:76465447-76465469 CTGTATTTCACCACTGAGTATGG - Intronic
997394148 5:133544255-133544277 ATGTTTTCCAACAGGAAGAATGG - Intronic
1002081916 5:176742423-176742445 CTGTGTCCCAGCACTGAGAATGG - Intergenic
1003451903 6:6242759-6242781 ATAATTTCCACCATGGAGAAAGG + Intronic
1008818382 6:55598632-55598654 CTGTTTGCCTCAACAGAGAACGG - Intergenic
1011194752 6:84769243-84769265 CCGTTTTCCAGCTTGGAGAAAGG + Intergenic
1011559770 6:88602704-88602726 TTGTTCTCCACCATGGAGACTGG - Intergenic
1011960204 6:93079270-93079292 CTCTCTTCCACCCCAGAGAAGGG + Intergenic
1012118408 6:95333847-95333869 CTGTCTTCCACGTCAGAGAATGG - Intergenic
1012119604 6:95348453-95348475 CTGATTTTCACTACAGAGAATGG + Intergenic
1014353517 6:120374402-120374424 TTGTTTTCCACCACATAGTAAGG - Intergenic
1018278370 6:162157360-162157382 CTGATTACCCCCACCGAGAATGG + Intronic
1020815652 7:12902282-12902304 ATGTTTTCCACCATGGTTAAGGG - Intergenic
1024174636 7:46826448-46826470 CTGTTTCCCATCAGGGAAAAGGG + Intergenic
1025090388 7:56058007-56058029 TTGTTTTGGACCACGGAGCACGG + Exonic
1027492998 7:78853796-78853818 CTGTTGTCCACCACCAAGAGAGG - Intronic
1030938976 7:115621088-115621110 CTGTCTTCTACCATGGAGCAAGG + Intergenic
1032171045 7:129584856-129584878 CTGTTTTCCAACAGGGATCAAGG - Intergenic
1042798970 8:72696811-72696833 TTGTTTTCCTCTATGGAGAAGGG + Intronic
1043423182 8:80121354-80121376 CTCTTATCCTGCACGGAGAAGGG - Intronic
1049026042 8:139989598-139989620 CTGTTTGCTTCCAGGGAGAAAGG - Intronic
1054963316 9:70993895-70993917 CTGTTTTCCCCCCAGGAGAGAGG - Intronic
1058259173 9:102809032-102809054 CAGTTTTTGACCACGCAGAAAGG + Intergenic
1059168610 9:112103068-112103090 ATGTTTTCTACCAATGAGAAAGG + Intronic
1059259943 9:112966047-112966069 GTGCTTTCCAGCAGGGAGAAAGG + Intergenic
1059782080 9:117540507-117540529 CTGTTTTTGTCCACGGATAAAGG - Intergenic
1060924439 9:127446226-127446248 CTGTTCTCCATGAGGGAGAAGGG - Intergenic
1061123539 9:128659153-128659175 CAGTTTACCACCACCTAGAAAGG + Intergenic
1186874455 X:13803338-13803360 GTGATTTGCACCACAGAGAATGG - Intronic
1187197723 X:17104037-17104059 CTGTTTTCATCCCCAGAGAAGGG + Intronic
1187485444 X:19698964-19698986 CTGATTTCCCCCACAGAAAAAGG + Intronic
1188982682 X:36741181-36741203 CTATTTCCCACCAGTGAGAATGG - Intergenic
1190314481 X:49141385-49141407 CTGTTTTCCAGCAGGGATCAAGG + Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1198328142 X:135595251-135595273 CTGTTTCCCACCTCGGATAGGGG - Intergenic
1199074091 X:143510398-143510420 CTGGATTCCACCTGGGAGAAGGG - Intronic
1199930005 X:152508316-152508338 ATGTTTTCCAACAAGGAGAAGGG - Intergenic